Incidental Mutation 'R2874:Ext2'
ID260449
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
Synonyms
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93739686 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 460 (V460A)
Ref Sequence ENSEMBL: ENSMUSP00000138956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000184931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028623
AA Change: V460A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: V460A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123649
Predicted Effect probably benign
Transcript: ENSMUST00000125407
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184931
AA Change: V460A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: V460A

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R0580:Ext2 UTSW 2 93795725 missense probably benign 0.31
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1538:Ext2 UTSW 2 93707287 missense probably damaging 1.00
R1743:Ext2 UTSW 2 93730225 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4826:Ext2 UTSW 2 93762630 missense probably benign 0.15
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7173:Ext2 UTSW 2 93813612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTCAGTGCAGTTAGG -3'
(R):5'- TCGCAGCTCATGTACTCTGTG -3'

Sequencing Primer
(F):5'- AAGTCAGTGCAGTTAGGGGTGC -3'
(R):5'- CCTTCTCAGTGGTGTCAGACAG -3'
Posted On2015-01-23