Incidental Mutation 'R2874:St7'
ID260455
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Namesuppression of tumorigenicity 7
SynonymsRAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17692933-17943025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17819277 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 60 (P60L)
Ref Sequence ENSEMBL: ENSMUSP00000115215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
Predicted Effect probably damaging
Transcript: ENSMUST00000000674
AA Change: P14L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: P14L

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052113
AA Change: P60L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053148
AA Change: P17L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: P17L

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077080
AA Change: P14L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: P14L

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: P60L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115417
AA Change: P17L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: P17L

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115418
AA Change: P60L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: P60L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115420
AA Change: P60L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect probably damaging
Transcript: ENSMUST00000144488
AA Change: P60L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534
AA Change: P60L

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
IGL02980:St7 UTSW 6 17749546 intron probably benign
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2039:St7 UTSW 6 17886112 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3076:St7 UTSW 6 17846238 nonsense probably null
R3921:St7 UTSW 6 17846245 missense probably benign 0.31
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5358:St7 UTSW 6 17819318 missense probably damaging 1.00
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 unclassified probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGACTTTGCTAACGTTC -3'
(R):5'- CTCTTTATCCCCATCCAACATGAAG -3'

Sequencing Primer
(F):5'- GCAGGGGTTCAGTTTCTAAAACC -3'
(R):5'- GACACAAAATGAATATTGAGAACTGC -3'
Posted On2015-01-23