Incidental Mutation 'R2874:Arhgef10'
ID260465
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission 040462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2874 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14975666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 459 (I459V)
Ref Sequence ENSEMBL: ENSMUSP00000125526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]
Predicted Effect probably benign
Transcript: ENSMUST00000084207
AA Change: I787V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: I787V

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110800
AA Change: I748V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: I748V

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163062
AA Change: I459V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: I459V

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T A 13: 58,382,570 I209F probably damaging Het
4931428F04Rik A G 8: 105,282,032 M451T possibly damaging Het
A930029G22Rik T A 17: 69,418,111 noncoding transcript Het
Ankrd42 T C 7: 92,605,358 K348E possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Cebpz A T 17: 78,932,103 probably benign Het
Clcn4 A G 7: 7,290,521 I412T probably benign Het
Clstn3 T A 6: 124,438,335 D690V probably damaging Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Ext2 A G 2: 93,739,686 V460A possibly damaging Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Fscb T C 12: 64,473,436 K419E probably benign Het
Ggct G T 6: 54,992,774 A21D probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Itpr2 T C 6: 146,426,498 K79R possibly damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lrp1b A G 2: 40,851,693 L3188P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Noc4l A G 5: 110,649,103 V465A probably benign Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plxna3 T A X: 74,339,396 probably benign Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Prps1 C T X: 140,471,994 probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ralgds A G 2: 28,548,769 probably null Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rreb1 T C 13: 37,916,508 I205T probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tep1 A G 14: 50,850,650 I85T possibly damaging Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6592:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6592:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCCATGCCAGAGCTCTG -3'
(R):5'- TCTGCACGGTACACATACAG -3'

Sequencing Primer
(F):5'- TCACAGCCTTTGGTAGCATGAAG -3'
(R):5'- TACAGTCAGCCTGCACGGTAC -3'
Posted On2015-01-23