Incidental Mutation 'R2875:Irf8'
ID260512
Institutional Source Beutler Lab
Gene Symbol Irf8
Ensembl Gene ENSMUSG00000041515
Gene Nameinterferon regulatory factor 8
SynonymsIcsbp1, ICSBP, Myls, IRF-8
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120736358-120756694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120754463 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 262 (P262Q)
Ref Sequence ENSEMBL: ENSMUSP00000125447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047737] [ENSMUST00000127664] [ENSMUST00000160943] [ENSMUST00000162001] [ENSMUST00000162658]
Predicted Effect probably damaging
Transcript: ENSMUST00000047737
AA Change: P353Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040245
Gene: ENSMUSG00000041515
AA Change: P353Q

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160594
Predicted Effect probably damaging
Transcript: ENSMUST00000160943
AA Change: P262Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125447
Gene: ENSMUSG00000041515
AA Change: P262Q

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
IRF-3 111 289 2.63e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162001
AA Change: P353Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125029
Gene: ENSMUSG00000041515
AA Change: P353Q

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162658
SMART Domains Protein: ENSMUSP00000125443
Gene: ENSMUSG00000041515

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
Pfam:IRF-3 111 151 4.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Irf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Irf8 APN 8 120753380 missense probably damaging 1.00
IGL02944:Irf8 APN 8 120755125 missense probably benign 0.00
IGL03024:Irf8 APN 8 120753358 missense probably damaging 0.98
gemini UTSW 8 120743883 nonsense probably null
gemini2 UTSW 8 120753707 missense probably damaging 0.97
glenn UTSW 8 120739842 missense probably damaging 1.00
ANU74:Irf8 UTSW 8 120739869 missense possibly damaging 0.75
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0840:Irf8 UTSW 8 120753481 missense probably benign 0.06
R1622:Irf8 UTSW 8 120739822 missense possibly damaging 0.86
R1715:Irf8 UTSW 8 120754388 missense probably damaging 0.98
R2274:Irf8 UTSW 8 120753527 missense probably damaging 0.99
R3743:Irf8 UTSW 8 120753571 missense probably damaging 1.00
R4209:Irf8 UTSW 8 120753469 missense probably damaging 0.99
R4729:Irf8 UTSW 8 120753439 missense probably damaging 0.99
R6343:Irf8 UTSW 8 120753707 missense probably damaging 0.97
R6950:Irf8 UTSW 8 120755125 missense probably benign 0.00
R7051:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7052:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7249:Irf8 UTSW 8 120739832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTTGGTTGGCTTCTAGCTAAG -3'
(R):5'- AACGTGGGAAGCCATCACAG -3'

Sequencing Primer
(F):5'- GCTAAGCAGCCTTGTATCCTAGG -3'
(R):5'- TGGGAAGCCATCACAGAGGTG -3'
Posted On2015-01-23