Incidental Mutation 'R2875:Olfr193'
ID260530
Institutional Source Beutler Lab
Gene Symbol Olfr193
Ensembl Gene ENSMUSG00000060057
Gene Nameolfactory receptor 193
SynonymsOlfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2875 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59107924-59111881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59109802 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 269 (D269E)
Ref Sequence ENSEMBL: ENSMUSP00000146393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]
Predicted Effect probably benign
Transcript: ENSMUST00000076262
AA Change: D269E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: D269E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-48 PFAM
Pfam:7tm_1 41 290 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207935
Predicted Effect probably benign
Transcript: ENSMUST00000208455
AA Change: D269E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Eno1b A G 18: 48,047,784 K343R possibly damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Olfr193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr193 APN 16 59110598 missense probably benign
IGL01613:Olfr193 APN 16 59109921 missense probably damaging 1.00
IGL02280:Olfr193 APN 16 59110332 missense probably damaging 1.00
IGL02533:Olfr193 APN 16 59109684 missense probably benign
IGL02544:Olfr193 APN 16 59110144 missense probably damaging 1.00
IGL02576:Olfr193 APN 16 59109771 missense probably benign
IGL02719:Olfr193 APN 16 59110173 missense probably benign 0.01
IGL03215:Olfr193 APN 16 59109962 missense possibly damaging 0.46
IGL03272:Olfr193 APN 16 59110556 missense probably benign 0.01
PIT4802001:Olfr193 UTSW 16 59110601 missense probably benign
R0544:Olfr193 UTSW 16 59110225 missense probably benign 0.03
R0783:Olfr193 UTSW 16 59110169 nonsense probably null
R1070:Olfr193 UTSW 16 59109819 missense probably benign 0.08
R1211:Olfr193 UTSW 16 59110160 missense possibly damaging 0.68
R1662:Olfr193 UTSW 16 59110604 missense probably benign 0.00
R1754:Olfr193 UTSW 16 59110581 missense probably benign 0.03
R1765:Olfr193 UTSW 16 59109755 missense probably damaging 1.00
R1937:Olfr193 UTSW 16 59109794 missense probably benign 0.11
R2910:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R2911:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R5084:Olfr193 UTSW 16 59110073 missense possibly damaging 0.90
R5700:Olfr193 UTSW 16 59109993 missense probably damaging 0.99
R7018:Olfr193 UTSW 16 59110607 start codon destroyed probably null 0.98
R7083:Olfr193 UTSW 16 59110037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCACCTATTTGCCATG -3'
(R):5'- TGACCCTTCTATCAATTACCTGATG -3'

Sequencing Primer
(F):5'- GCACCTATTTGCCATGTTTTAATAAG -3'
(R):5'- CTGGCTCAATTCAGGTATTCAC -3'
Posted On2015-01-23