Incidental Mutation 'R2875:Eno1b'
ID260533
Institutional Source Beutler Lab
Gene Symbol Eno1b
Ensembl Gene ENSMUSG00000059040
Gene Nameenolase 1B, retrotransposed
SynonymsGm5506
MMRRC Submission 040463-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R2875 (G1)
Quality Score177
Status Not validated
Chromosome18
Chromosomal Location48045335-48048378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48047784 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 343 (K343R)
Ref Sequence ENSEMBL: ENSMUSP00000075513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076155
AA Change: K343R

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075513
Gene: ENSMUSG00000059040
AA Change: K343R

DomainStartEndE-ValueType
Enolase_N 3 134 4.75e-91 SMART
Enolase_C 142 431 1.22e-207 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: This gene may represent an evolving pseudogene of the alpha-enolase (enolase 1, alpha non-neuron) gene, which has multiple pseudogenes. This gene has an intact open reading frame as well as strong transcriptional support. The length of encoded protein is conserved, compared to the original enolase 1 protein. The exact function of this gene is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,422,719 T422P probably damaging Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Baz1a A T 12: 54,923,119 D585E probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Dnah12 A G 14: 26,693,470 I9V probably benign Het
Dnah12 A G 14: 26,876,950 N995S probably benign Het
Dnah9 C A 11: 66,168,461 G3C possibly damaging Het
Dock2 A G 11: 34,718,885 S243P probably damaging Het
Eif2ak3 T C 6: 70,883,639 S400P probably damaging Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Gm5346 T A 8: 43,627,140 K16* probably null Het
Grk6 A G 13: 55,452,304 H271R probably damaging Het
H2-Ab1 A C 17: 34,263,312 M1L probably benign Het
Irf8 C A 8: 120,754,463 P262Q probably damaging Het
Kcnc3 G T 7: 44,591,537 G218* probably null Het
Krt9 C A 11: 100,189,205 G454* probably null Het
Mgrn1 C T 16: 4,907,416 T47I possibly damaging Het
Ndst1 A T 18: 60,690,047 F816I probably damaging Het
Olfr193 A T 16: 59,109,802 D269E probably benign Het
Olfr742 T A 14: 50,515,812 W203R probably benign Het
Phf12 C A 11: 78,009,747 T223N probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rad54l C T 4: 116,101,853 R382Q probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Smarca4 A T 9: 21,642,580 K387N possibly damaging Het
St3gal5 A G 6: 72,147,130 M214V possibly damaging Het
Stk25 T C 1: 93,629,251 D15G possibly damaging Het
Timm21 T C 18: 84,951,092 D69G probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn T A 2: 76,759,094 N21272I probably damaging Het
Uchl3 A G 14: 101,668,560 H153R probably benign Het
Zcwpw1 T C 5: 137,810,042 S251P probably damaging Het
Zeb1 GGA GGAAGA 18: 5,772,859 probably benign Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Eno1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03196:Eno1b APN 18 48047491 missense probably damaging 1.00
R0025:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0153:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0173:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0230:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0233:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0396:Eno1b UTSW 18 48047739 missense probably benign 0.01
R0597:Eno1b UTSW 18 48047739 missense probably benign 0.01
R1834:Eno1b UTSW 18 48047463 missense probably damaging 1.00
R2094:Eno1b UTSW 18 48047475 missense possibly damaging 0.92
R4240:Eno1b UTSW 18 48047840 missense probably benign
R4611:Eno1b UTSW 18 48047703 missense probably damaging 1.00
R6917:Eno1b UTSW 18 48047589 missense probably benign
R7114:Eno1b UTSW 18 48047493 missense possibly damaging 0.88
R7217:Eno1b UTSW 18 48047679 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGATCTGTACAAGTCCTTCG -3'
(R):5'- AAGGATCTGGTTGTACTTGGCC -3'

Sequencing Primer
(F):5'- TTCGTCCAGAACTACCCAGTGG -3'
(R):5'- TTGTACTTGGCCAGGCGC -3'
Posted On2015-01-23