Incidental Mutation 'R2876:Adgb'
ID260561
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 040464-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10422719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 422 (T422P)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably damaging
Transcript: ENSMUST00000045328
AA Change: T24P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994
AA Change: T24P

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132573
AA Change: T422P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: T422P

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172530
AA Change: T422P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: T422P

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179956
AA Change: T422P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: T422P

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208717
AA Change: T398P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,533,643 Q235K possibly damaging Het
Abcc1 A T 16: 14,457,960 H906L probably benign Het
Acot6 T G 12: 84,101,262 D97E possibly damaging Het
Acvr2a T A 2: 48,892,178 M241K probably damaging Het
Adamts9 T C 6: 92,795,910 probably benign Het
Adrm1 A G 2: 180,175,618 T293A probably damaging Het
Ankfn1 A G 11: 89,391,636 V395A possibly damaging Het
Atp2b1 A G 10: 98,999,745 M451V probably damaging Het
Ccdc152 T C 15: 3,298,181 N38S probably damaging Het
Cdh23 A T 10: 60,307,496 N3017K probably damaging Het
Cenpf A G 1: 189,658,644 M997T probably benign Het
Gcc2 A G 10: 58,290,302 E1344G probably damaging Het
Gen1 A C 12: 11,242,068 S573R probably benign Het
Gm38394 C T 1: 133,656,860 C913Y probably damaging Het
Ilvbl C A 10: 78,583,056 Q410K probably benign Het
Ints11 C A 4: 155,887,425 probably benign Het
Itfg1 T C 8: 85,780,510 probably benign Het
Lrrc27 C T 7: 139,228,684 probably benign Het
Maml3 G A 3: 51,690,059 A422V possibly damaging Het
Masp2 T A 4: 148,608,001 I317K probably benign Het
Olfr154 A G 2: 85,663,690 V248A probably damaging Het
Olfr700 C G 7: 106,805,997 S155T probably benign Het
Olfr702 A T 7: 106,824,457 V23E probably benign Het
Papln T A 12: 83,778,927 S661T probably damaging Het
Pi4ka A G 16: 17,367,550 S229P possibly damaging Het
Piezo2 A G 18: 63,053,035 S1688P probably damaging Het
Pzp T C 6: 128,491,550 T1005A probably damaging Het
Rad1 T C 15: 10,490,331 V128A probably benign Het
Rhbdd1 A G 1: 82,368,369 D215G probably benign Het
Rnft2 G A 5: 118,193,621 R417C probably damaging Het
Scn2a A C 2: 65,715,897 I935L possibly damaging Het
Sdc4 T C 2: 164,431,291 D33G possibly damaging Het
Slco1c1 T C 6: 141,559,856 S454P probably damaging Het
Spidr A T 16: 15,912,589 probably null Het
Srp72 T A 5: 76,995,920 probably benign Het
Ttll4 A G 1: 74,686,438 probably null Het
Ttn C T 2: 76,920,340 S3455N probably damaging Het
Vcan T A 13: 89,704,237 E868V probably damaging Het
Vmn2r89 G T 14: 51,455,084 G115C possibly damaging Het
Zscan29 T C 2: 121,164,100 Y468C probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TAGTGCTATGCAAAACTGAGACG -3'
(R):5'- GGAAAAGATACCAGCTATATTTCCC -3'

Sequencing Primer
(F):5'- CTGAGACGATTGAAATGTTCCAAC -3'
(R):5'- AAGATACCAGCTATATTTCCCCTCTC -3'
Posted On2015-01-23