Incidental Mutation 'R2894:Ccl4'
List |< first << previous [record 36 of 217] next >> last >|
ID260711
Institutional Source Beutler Lab
Gene Symbol Ccl4
Ensembl Gene ENSMUSG00000018930
Gene Namechemokine (C-C motif) ligand 4
SynonymsAct-2, MIP-1B, MIP-1 beta, Scya4, AT744.1, Mip1b
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83662584-83664683 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to A at 83663503 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019074]
Predicted Effect probably null
Transcript: ENSMUST00000019074
SMART Domains Protein: ENSMUSP00000019074
Gene: ENSMUSG00000018930

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 89 9.92e-32 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fmo6 C T 1: 162,922,724 W254* probably null Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Msh3 G T 13: 92,342,360 A367D probably benign Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr558 A G 7: 102,709,675 T139A probably damaging Het
Olfr847 A T 9: 19,375,292 Y196* probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Tmem232 C T 17: 65,450,413 E262K probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Ccl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03217:Ccl4 APN 11 83662678 missense unknown
R0302:Ccl4 UTSW 11 83663454 splice site probably benign
R0328:Ccl4 UTSW 11 83663557 missense probably damaging 0.98
R1342:Ccl4 UTSW 11 83663576 splice site probably benign
R4934:Ccl4 UTSW 11 83662678 missense unknown
R6334:Ccl4 UTSW 11 83662678 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCATTCTGGGTGGATGACC -3'
(R):5'- ACACTTTACTGCCCATCCAG -3'

Sequencing Primer
(F):5'- TGACCATAGATTTCAGGGACCATG -3'
(R):5'- ATGACCTCACTGTTCTTTGGCAGAG -3'
Posted On2015-01-23