Incidental Mutation 'R2894:Msh3'
ID260714
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R2894 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92342360 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 367 (A367D)
Ref Sequence ENSEMBL: ENSMUSP00000022220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022220
AA Change: A367D

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: A367D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
AA Change: A367D

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: A367D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189376
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Ccl4 C A 11: 83,663,503 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fmo6 C T 1: 162,922,724 W254* probably null Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr558 A G 7: 102,709,675 T139A probably damaging Het
Olfr847 A T 9: 19,375,292 Y196* probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Tmem232 C T 17: 65,450,413 E262K probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTAAGAATAAGCATTGGTTTGGG -3'
(R):5'- TAGATGCCTGTGACTCTAACTTACATC -3'

Sequencing Primer
(F):5'- TTGGGAAGTCACTCCAGTGTGAAC -3'
(R):5'- CTGTGACTCTAACTTACATCAGAGTC -3'
Posted On2015-01-23