Incidental Mutation 'R2895:Cd96'
ID260768
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene NameCD96 antigen
Synonyms1700109I12Rik, Tactile
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location46035657-46120251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46117805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 99 (T99K)
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
Predicted Effect probably benign
Transcript: ENSMUST00000023336
AA Change: T99K

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657
AA Change: T99K

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 46071799 missense possibly damaging 0.85
IGL00588:Cd96 APN 16 46038554 missense probably benign 0.04
IGL00916:Cd96 APN 16 46041312 missense probably benign 0.07
IGL01080:Cd96 APN 16 46049693 missense possibly damaging 0.67
IGL01538:Cd96 APN 16 46109127 missense possibly damaging 0.67
IGL02350:Cd96 APN 16 46069776 splice site probably benign
IGL02357:Cd96 APN 16 46069776 splice site probably benign
IGL02892:Cd96 APN 16 46049797 critical splice acceptor site probably null
R0119:Cd96 UTSW 16 46038579 splice site probably benign
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0515:Cd96 UTSW 16 46063905 splice site probably benign
R0655:Cd96 UTSW 16 46099119 missense probably benign 0.06
R0684:Cd96 UTSW 16 46117790 missense possibly damaging 0.96
R0838:Cd96 UTSW 16 46117926 missense probably damaging 1.00
R1531:Cd96 UTSW 16 46117806 missense probably benign 0.03
R1664:Cd96 UTSW 16 46118001 missense possibly damaging 0.95
R1791:Cd96 UTSW 16 46117999 nonsense probably null
R1840:Cd96 UTSW 16 46099092 missense probably benign 0.36
R1873:Cd96 UTSW 16 46117972 missense probably damaging 1.00
R2906:Cd96 UTSW 16 46051487 missense possibly damaging 0.56
R4291:Cd96 UTSW 16 46071749 missense probably damaging 0.98
R5112:Cd96 UTSW 16 46098938 missense probably benign
R5261:Cd96 UTSW 16 46069653 missense probably benign 0.39
R5274:Cd96 UTSW 16 46069703 missense possibly damaging 0.78
R5934:Cd96 UTSW 16 46117903 missense probably benign 0.43
R6002:Cd96 UTSW 16 46117986 missense possibly damaging 0.61
R6758:Cd96 UTSW 16 46118004 missense possibly damaging 0.50
R6992:Cd96 UTSW 16 46049724 missense possibly damaging 0.65
R7239:Cd96 UTSW 16 46109114 missense probably damaging 1.00
R7308:Cd96 UTSW 16 46071734 critical splice donor site probably null
R7316:Cd96 UTSW 16 46069653 missense probably benign 0.39
R7355:Cd96 UTSW 16 46041292 missense possibly damaging 0.51
X0017:Cd96 UTSW 16 46049774 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATACCAAATGTAGACAGTGTCTGC -3'
(R):5'- CTGACATCAACTTGACCTGCC -3'

Sequencing Primer
(F):5'- GCTGTCTTCGTGTATTCACTAAATG -3'
(R):5'- TTGACCTGCCAAACAAAGGAG -3'
Posted On2015-01-23