Incidental Mutation 'R0334:Hdac4'
ID26079
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 91956038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644] [ENSMUST00000187308]
Predicted Effect probably benign
Transcript: ENSMUST00000008995
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097644
Predicted Effect probably benign
Transcript: ENSMUST00000187308
SMART Domains Protein: ENSMUSP00000140092
Gene: ENSMUSG00000026313

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 93 313 2.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0288:Hdac4 UTSW 1 91971006 missense probably damaging 1.00
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1732:Hdac4 UTSW 1 91947535 missense probably benign 0.01
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R2384:Hdac4 UTSW 1 91984485 missense probably benign 0.02
R3705:Hdac4 UTSW 1 91934694 splice site probably benign
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R4440:Hdac4 UTSW 1 91945995 missense probably damaging 1.00
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 intron probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAACCTGAGCTGTAACAAGTG -3'
(R):5'- TGACGTGCCTGTAAGTAGCCAACC -3'

Sequencing Primer
(F):5'- GTGAAATACTACTTCTGTGGCAGATG -3'
(R):5'- GTCAGGACTACACTATGTGCTCAG -3'
Posted On2013-04-16