Incidental Mutation 'R2896:Crebbp'
ID260804
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4138816 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 381 (L381P)
Ref Sequence ENSEMBL: ENSMUSP00000146330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205765]
Predicted Effect probably damaging
Transcript: ENSMUST00000023165
AA Change: L381P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: L381P

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205765
AA Change: L381P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGAGTGCCACATGTG -3'
(R):5'- CAGTTGCAAACATCAGTGGG -3'

Sequencing Primer
(F):5'- ACTGTGGGAACAGCATATTCTAGGTC -3'
(R):5'- ACATCAGTGGGAATTGTACCC -3'
Posted On2015-01-23