Incidental Mutation 'R2897:Ankk1'
ID260851
Institutional Source Beutler Lab
Gene Symbol Ankk1
Ensembl Gene ENSMUSG00000032257
Gene Nameankyrin repeat and kinase domain containing 1
Synonyms9930020N01Rik
MMRRC Submission 040485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49415194-49427021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49421822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 121 (T121S)
Ref Sequence ENSEMBL: ENSMUSP00000034792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034792]
Predicted Effect probably benign
Transcript: ENSMUST00000034792
AA Change: T121S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034792
Gene: ENSMUSG00000032257
AA Change: T121S

DomainStartEndE-ValueType
Pfam:Pkinase 35 298 4.1e-44 PFAM
Pfam:Pkinase_Tyr 36 297 7.6e-47 PFAM
ANK 369 398 1.36e-2 SMART
ANK 402 431 4.13e-2 SMART
ANK 435 464 3.51e-5 SMART
ANK 468 497 5.62e-4 SMART
ANK 501 530 5.71e-5 SMART
ANK 534 563 1.05e-3 SMART
ANK 567 596 1.12e-3 SMART
ANK 600 629 6.12e-5 SMART
ANK 633 662 1.59e-3 SMART
ANK 666 695 3.65e-3 SMART
ANK 699 728 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216227
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nlrc4 T A 17: 74,448,045 M59L probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Vps41 T C 13: 18,810,428 probably benign Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Other mutations in Ankk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ankk1 APN 9 49421900 missense probably benign 0.30
IGL00495:Ankk1 APN 9 49415843 missense probably benign 0.00
IGL01316:Ankk1 APN 9 49420484 unclassified probably benign
IGL01359:Ankk1 APN 9 49416028 missense possibly damaging 0.95
IGL01464:Ankk1 APN 9 49415972 missense probably benign 0.26
IGL01719:Ankk1 APN 9 49416781 missense probably benign 0.08
IGL02057:Ankk1 APN 9 49416772 missense probably damaging 1.00
IGL02549:Ankk1 APN 9 49418693 missense probably damaging 1.00
IGL02690:Ankk1 APN 9 49421900 missense probably damaging 0.99
IGL03083:Ankk1 APN 9 49421866 missense probably benign 0.15
IGL03168:Ankk1 APN 9 49415768 missense possibly damaging 0.89
IGL03289:Ankk1 APN 9 49415695 missense probably benign 0.00
R0319:Ankk1 UTSW 9 49416071 missense probably damaging 0.97
R0539:Ankk1 UTSW 9 49418030 missense probably benign
R0827:Ankk1 UTSW 9 49421737 missense possibly damaging 0.81
R1474:Ankk1 UTSW 9 49415839 missense probably damaging 1.00
R1818:Ankk1 UTSW 9 49420425 missense probably benign 0.06
R1851:Ankk1 UTSW 9 49415850 missense probably benign
R2044:Ankk1 UTSW 9 49419364 critical splice donor site probably null
R2088:Ankk1 UTSW 9 49421965 unclassified probably benign
R2353:Ankk1 UTSW 9 49418690 missense probably benign
R2898:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R3121:Ankk1 UTSW 9 49426967 missense probably benign 0.21
R3714:Ankk1 UTSW 9 49421713 missense possibly damaging 0.92
R4455:Ankk1 UTSW 9 49418066 missense probably benign 0.00
R4757:Ankk1 UTSW 9 49415930 missense probably benign
R4893:Ankk1 UTSW 9 49415683 missense probably benign 0.00
R5090:Ankk1 UTSW 9 49421763 missense probably damaging 0.98
R5521:Ankk1 UTSW 9 49420448 missense probably benign 0.05
R5812:Ankk1 UTSW 9 49426853 missense probably benign 0.00
R5853:Ankk1 UTSW 9 49418695 missense possibly damaging 0.58
R5873:Ankk1 UTSW 9 49415896 missense probably benign 0.19
R6119:Ankk1 UTSW 9 49426883 missense possibly damaging 0.88
R6328:Ankk1 UTSW 9 49416071 missense possibly damaging 0.84
R6606:Ankk1 UTSW 9 49416346 missense probably benign 0.29
R6689:Ankk1 UTSW 9 49420476 missense probably damaging 1.00
R6745:Ankk1 UTSW 9 49416180 missense probably benign 0.00
R6856:Ankk1 UTSW 9 49420020 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AAGAGGTCTAGCGTACATCGTC -3'
(R):5'- GCATTCGTGCATTTTGCCAC -3'

Sequencing Primer
(F):5'- TCTAGCGTACATCGTCAGGGC -3'
(R):5'- GCCACTTGCCCTGGTAATTC -3'
Posted On2015-01-23