Incidental Mutation 'R2897:Sycp3'
ID260858
Institutional Source Beutler Lab
Gene Symbol Sycp3
Ensembl Gene ENSMUSG00000020059
Gene Namesynaptonemal complex protein 3
SynonymsScp3, Cor1
MMRRC Submission 040485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88459569-88473236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88472682 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 205 (E205K)
Ref Sequence ENSEMBL: ENSMUSP00000137800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020252] [ENSMUST00000020253] [ENSMUST00000117440] [ENSMUST00000123244] [ENSMUST00000125612] [ENSMUST00000126074] [ENSMUST00000139109] [ENSMUST00000148899]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020252
AA Change: E205K

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020252
Gene: ENSMUSG00000020059
AA Change: E205K

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 101 229 6.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020253
SMART Domains Protein: ENSMUSP00000020253
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 183 1e-24 PFAM
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117440
SMART Domains Protein: ENSMUSP00000112708
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 61 136 8.8e-18 PFAM
transmembrane domain 159 181 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123244
SMART Domains Protein: ENSMUSP00000137704
Gene: ENSMUSG00000020059

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125612
AA Change: E205K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137800
Gene: ENSMUSG00000020059
AA Change: E205K

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 100 229 7.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126074
SMART Domains Protein: ENSMUSP00000123429
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 206 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134318
SMART Domains Protein: ENSMUSP00000122428
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139109
SMART Domains Protein: ENSMUSP00000116413
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 59 183 1e-24 PFAM
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143108
SMART Domains Protein: ENSMUSP00000117620
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 27 102 1.9e-18 PFAM
transmembrane domain 125 147 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148899
SMART Domains Protein: ENSMUSP00000120167
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential structural component of the synaptonemal complex. This complex is involved in synapsis, recombination and segregation of meiotic chromosomes. Mutations in this gene are associated with azoospermia in males and susceptibility to pregnancy loss in females. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutants are male infertile and female sub-fertile. Reduced litter size in females is due to achiasmatic oocytes, resulting in aneuploidy and embryonic death. Meiosis in males blocks at early prophase with lack of synaptonemal complexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nlrc4 T A 17: 74,448,045 M59L probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Vps41 T C 13: 18,810,428 probably benign Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Other mutations in Sycp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sycp3 APN 10 88466472 missense possibly damaging 0.65
IGL02402:Sycp3 APN 10 88466563 intron probably benign
PIT4378001:Sycp3 UTSW 10 88466504 nonsense probably null
R1468:Sycp3 UTSW 10 88469592 missense possibly damaging 0.75
R1468:Sycp3 UTSW 10 88469592 missense possibly damaging 0.75
R2857:Sycp3 UTSW 10 88467372 missense probably damaging 1.00
R2858:Sycp3 UTSW 10 88467372 missense probably damaging 1.00
R2898:Sycp3 UTSW 10 88472682 missense possibly damaging 0.92
R4194:Sycp3 UTSW 10 88463375 missense probably benign 0.01
R5683:Sycp3 UTSW 10 88472935 missense probably damaging 1.00
R6882:Sycp3 UTSW 10 88472929 nonsense probably null
R7273:Sycp3 UTSW 10 88469566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGATGTCTTAAGAAACTTAC -3'
(R):5'- GCTGCTGTTTCATGAAAGGAG -3'

Sequencing Primer
(F):5'- ATTGCCCAGACTAGCCTCAAATTTG -3'
(R):5'- CTGCTGTTTCATGAAAGGAGATATG -3'
Posted On2015-01-23