Incidental Mutation 'R2897:Nlrc4'
ID260878
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
MMRRC Submission 040485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74448045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 59 (M59L)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052124]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000052124
AA Change: M59L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: M59L

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Vps41 T C 13: 18,810,428 probably benign Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
PIT4466001:Nlrc4 UTSW 17 74427119 missense probably benign 0.01
R0077:Nlrc4 UTSW 17 74446831 missense probably damaging 1.00
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1690:Nlrc4 UTSW 17 74437523 nonsense probably null
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6654:Nlrc4 UTSW 17 74445528 missense possibly damaging 0.55
R6712:Nlrc4 UTSW 17 74446836 missense probably damaging 0.96
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCCATGGAAGGGACTG -3'
(R):5'- CTCTGATGCACTGGTAAGAGATATG -3'

Sequencing Primer
(F):5'- CCATGGAAGGGACTGTGGGTATTC -3'
(R):5'- CCCTCTCTTCAGTGAACTTTATAAGG -3'
Posted On2015-01-23