Incidental Mutation 'R2897:Pcdhb1'
ID260880
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission 040485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37266463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 489 (Y489C)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: Y489C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: Y489C

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nlrc4 T A 17: 74,448,045 M59L probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Vps41 T C 13: 18,810,428 probably benign Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATACTGGACCACCCAATC -3'
(R):5'- ATTGTCATTGTCGTCCAGGACC -3'

Sequencing Primer
(F):5'- GATACTGGACCACCCAATCTGTCC -3'
(R):5'- TCTGACAGTAACTTCGCTACTCAACG -3'
Posted On2015-01-23