Incidental Mutation 'R0334:Tchh'
ID26093
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Nametrichohyalin
SynonymsThh, AHF
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93442330-93449077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93445616 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 788 (R788S)
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
Predicted Effect unknown
Transcript: ENSMUST00000064257
AA Change: R788S
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415
AA Change: R788S

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93445299 missense unknown
IGL00338:Tchh APN 3 93447644 missense unknown
IGL00541:Tchh APN 3 93446250 missense unknown
IGL02510:Tchh APN 3 93444078 missense unknown
IGL02622:Tchh APN 3 93443412 missense probably damaging 1.00
IGL03164:Tchh APN 3 93445392 missense unknown
IGL03331:Tchh APN 3 93443418 missense probably damaging 1.00
R0603:Tchh UTSW 3 93443781 missense possibly damaging 0.91
R1186:Tchh UTSW 3 93448046 missense unknown
R1241:Tchh UTSW 3 93444972 missense unknown
R1610:Tchh UTSW 3 93444839 missense unknown
R1768:Tchh UTSW 3 93443575 missense possibly damaging 0.68
R1843:Tchh UTSW 3 93446780 missense unknown
R1866:Tchh UTSW 3 93447760 missense unknown
R1978:Tchh UTSW 3 93446799 missense unknown
R2008:Tchh UTSW 3 93445974 missense unknown
R2011:Tchh UTSW 3 93446961 missense unknown
R2087:Tchh UTSW 3 93443918 missense unknown
R2177:Tchh UTSW 3 93444132 missense unknown
R2292:Tchh UTSW 3 93442382 missense probably damaging 1.00
R2418:Tchh UTSW 3 93445629 missense unknown
R2877:Tchh UTSW 3 93444228 missense unknown
R2995:Tchh UTSW 3 93447750 small deletion probably benign
R2997:Tchh UTSW 3 93447750 small deletion probably benign
R3439:Tchh UTSW 3 93447393 missense unknown
R3440:Tchh UTSW 3 93445107 missense unknown
R3441:Tchh UTSW 3 93445107 missense unknown
R4063:Tchh UTSW 3 93446991 missense unknown
R4550:Tchh UTSW 3 93445310 missense unknown
R4720:Tchh UTSW 3 93447882 missense unknown
R4836:Tchh UTSW 3 93445148 missense unknown
R4836:Tchh UTSW 3 93447588 missense unknown
R4880:Tchh UTSW 3 93443823 missense possibly damaging 0.85
R4895:Tchh UTSW 3 93445686 missense unknown
R5188:Tchh UTSW 3 93446679 missense unknown
R5404:Tchh UTSW 3 93447675 missense unknown
R5435:Tchh UTSW 3 93443672 missense possibly damaging 0.53
R5578:Tchh UTSW 3 93444311 nonsense probably null
R5678:Tchh UTSW 3 93445626 missense unknown
R5697:Tchh UTSW 3 93445043 nonsense probably null
R5768:Tchh UTSW 3 93446181 missense unknown
R5809:Tchh UTSW 3 93445573 missense unknown
R5934:Tchh UTSW 3 93444112 missense unknown
R5945:Tchh UTSW 3 93445337 missense unknown
R6313:Tchh UTSW 3 93447851 missense unknown
R6329:Tchh UTSW 3 93446445 missense unknown
R6397:Tchh UTSW 3 93445866 missense unknown
R6818:Tchh UTSW 3 93443411 missense probably damaging 1.00
Z1088:Tchh UTSW 3 93445682 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCAGTTTCAGCGAGAGCAC -3'
(R):5'- TGGAATTTTCTGTCCCGTCTGAGC -3'

Sequencing Primer
(F):5'- CAGCTCCAGGGAGAATCG -3'
(R):5'- AATGATCTGTCCCGCAGC -3'
Posted On2013-04-16