Incidental Mutation 'R2883:Olfr1500'
ID260944
Institutional Source Beutler Lab
Gene Symbol Olfr1500
Ensembl Gene ENSMUSG00000054526
Gene Nameolfactory receptor 1500
SynonymsMOR212-4P, GA_x6K02T2RE5P-4160554-4159619
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13826882-13830488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13827875 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 174 (I174F)
Ref Sequence ENSEMBL: ENSMUSP00000151471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067670] [ENSMUST00000214475] [ENSMUST00000215760] [ENSMUST00000216287] [ENSMUST00000217079] [ENSMUST00000219674]
Predicted Effect probably damaging
Transcript: ENSMUST00000067670
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067303
Gene: ENSMUSG00000054526
AA Change: I174F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 220 9.5e-9 PFAM
Pfam:7tm_1 41 290 4.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214475
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214579
Predicted Effect probably damaging
Transcript: ENSMUST00000215760
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216287
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217079
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000219674
AA Change: I174F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Olfr1500
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Olfr1500 APN 19 13828063 missense possibly damaging 0.93
IGL03122:Olfr1500 APN 19 13827650 missense possibly damaging 0.91
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0118:Olfr1500 UTSW 19 13827565 missense possibly damaging 0.74
R0458:Olfr1500 UTSW 19 13828229 missense probably benign 0.01
R0507:Olfr1500 UTSW 19 13827776 missense possibly damaging 0.49
R0515:Olfr1500 UTSW 19 13827821 missense probably damaging 0.99
R0907:Olfr1500 UTSW 19 13827856 missense probably damaging 1.00
R1524:Olfr1500 UTSW 19 13828315 missense probably damaging 1.00
R4278:Olfr1500 UTSW 19 13828429 start gained probably benign
R4824:Olfr1500 UTSW 19 13828354 missense probably damaging 1.00
R4981:Olfr1500 UTSW 19 13828094 missense probably damaging 1.00
R5785:Olfr1500 UTSW 19 13827619 missense probably damaging 1.00
R6597:Olfr1500 UTSW 19 13828457 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGCACATGTTGAGAAGGTC -3'
(R):5'- ATCGATTGCTACCTCTTGGC -3'

Sequencing Primer
(F):5'- CACATGTTGAGAAGGTCTTGGCC -3'
(R):5'- TGGCTCTCATGGCCTACGAC -3'
Posted On2015-01-23