Incidental Mutation 'R0334:Bmp8b'
ID26096
Institutional Source Beutler Lab
Gene Symbol Bmp8b
Ensembl Gene ENSMUSG00000002384
Gene Namebone morphogenetic protein 8b
SynonymsOp3
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123105165-123132099 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 123114760 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect probably null
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102648
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The encoded protein may play a role in the generation of primordial germ cells, and has been shown to stimulate thermogenesis in brown adipose tissue. Male mice lacking a functional copy of this gene exhibit variable degrees of germ-cell deficiency. Homozygous knockout mice of both sexes exhibit impaired thermogenesis and reduced metabolic rate, resulting in weight gain. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: Incidence of lethality among homozygous null mutants is variable depending on genetic background and due to allantoic and embryonic abnormalities. Heterozygous and surviving homozygous males exhibit varying degrees of germ cell deficiency and infertility, also background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Bmp8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Bmp8b APN 4 123124409 missense probably benign 0.19
R0441:Bmp8b UTSW 4 123124515 missense probably damaging 1.00
R0472:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0609:Bmp8b UTSW 4 123121899 missense probably benign 0.06
R0732:Bmp8b UTSW 4 123105406 missense unknown
R1221:Bmp8b UTSW 4 123114711 missense probably damaging 1.00
R2200:Bmp8b UTSW 4 123123022 missense possibly damaging 0.81
R3847:Bmp8b UTSW 4 123116168 unclassified probably benign
R4003:Bmp8b UTSW 4 123121878 unclassified probably benign
R4777:Bmp8b UTSW 4 123122000 missense possibly damaging 0.61
R4834:Bmp8b UTSW 4 123123050 missense probably damaging 1.00
R4911:Bmp8b UTSW 4 123115237 missense probably damaging 1.00
R5207:Bmp8b UTSW 4 123115921 unclassified probably benign
R5509:Bmp8b UTSW 4 123114576 missense possibly damaging 0.78
R5549:Bmp8b UTSW 4 123124485 missense probably damaging 1.00
R5795:Bmp8b UTSW 4 123121968 missense possibly damaging 0.59
R6142:Bmp8b UTSW 4 123115250 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTACTCTGAGCACAAGCCATC -3'
(R):5'- GGAGTTTCAGGCCAAACCCCTTTC -3'

Sequencing Primer
(F):5'- TGTCTTCCAGTGGAACGC -3'
(R):5'- TCTCATGTCTGAGGCCCC -3'
Posted On2013-04-16