Incidental Mutation 'R2884:Olfr547'
ID260962
Institutional Source Beutler Lab
Gene Symbol Olfr547
Ensembl Gene ENSMUSG00000073979
Gene Nameolfactory receptor 547
SynonymsGA_x6K02T2PBJ9-5256044-5256988, MOR31-4
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102534749-102535684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102535232 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 162 (I162V)
Ref Sequence ENSEMBL: ENSMUSP00000095831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098229]
Predicted Effect probably benign
Transcript: ENSMUST00000098229
AA Change: I162V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095831
Gene: ENSMUSG00000073979
AA Change: I162V

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.1e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 277 6.7e-10 PFAM
Pfam:7tm_1 43 294 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Olfr547
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr547 APN 7 102534933 missense probably benign 0.31
IGL01522:Olfr547 APN 7 102535184 missense probably damaging 0.97
IGL02182:Olfr547 APN 7 102535568 missense probably benign 0.00
IGL02669:Olfr547 APN 7 102535661 missense probably benign
IGL03139:Olfr547 APN 7 102535310 missense possibly damaging 0.95
FR4976:Olfr547 UTSW 7 102535681 makesense probably null
R1246:Olfr547 UTSW 7 102534942 missense probably damaging 1.00
R3852:Olfr547 UTSW 7 102535280 missense probably benign 0.01
R4686:Olfr547 UTSW 7 102535149 missense probably damaging 1.00
R4879:Olfr547 UTSW 7 102534755 missense probably benign 0.00
R6169:Olfr547 UTSW 7 102535272 missense probably benign 0.02
R6213:Olfr547 UTSW 7 102534932 missense probably damaging 1.00
R7080:Olfr547 UTSW 7 102534965 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCCTGGATCGCTGTATCAC -3'
(R):5'- AGAGCTTTGTGGCGAGCATC -3'

Sequencing Primer
(F):5'- GTATCACTCAGCTCTTCTTCATCCAC -3'
(R):5'- AGCATCCTGGGAAGGCATGC -3'
Posted On2015-01-23