Incidental Mutation 'R2884:Pth'
ID260963
Institutional Source Beutler Lab
Gene Symbol Pth
Ensembl Gene ENSMUSG00000059077
Gene Nameparathyroid hormone
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location113385580-113388570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113386028 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 46 (L46Q)
Ref Sequence ENSEMBL: ENSMUSP00000078723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079793]
Predicted Effect probably damaging
Transcript: ENSMUST00000079793
AA Change: L46Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078723
Gene: ENSMUSG00000059077
AA Change: L46Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PTH 30 65 7.55e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit diminished cartilage mineralization, and reductions in angiopoietin-1, neovascularization, metaphyseal osteoblasts, and trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Pth
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2964:Pth UTSW 7 113385929 missense probably benign 0.00
R2965:Pth UTSW 7 113385929 missense probably benign 0.00
R2966:Pth UTSW 7 113385929 missense probably benign 0.00
R4650:Pth UTSW 7 113385819 makesense probably null
R5240:Pth UTSW 7 113385844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGCACTGTCTAGAATAAATC -3'
(R):5'- GTAAGTGCTGCAGCCCATTG -3'

Sequencing Primer
(F):5'- AATACATCCACATCAGCTTTGTC -3'
(R):5'- CCCATTGTGCACAGGGAAGTG -3'
Posted On2015-01-23