Incidental Mutation 'R2884:Lilrb4a'
ID260970
Institutional Source Beutler Lab
Gene Symbol Lilrb4a
Ensembl Gene ENSMUSG00000112148
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4A
SynonymsLilrb4, CD85K, ILT3, HM18, Gp49b
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location51490956-51496611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51491613 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 84 (N84Y)
Ref Sequence ENSEMBL: ENSMUSP00000151827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078778] [ENSMUST00000102894] [ENSMUST00000217705] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218617] [ENSMUST00000219696] [ENSMUST00000219960] [ENSMUST00000220182] [ENSMUST00000220226]
Predicted Effect probably benign
Transcript: ENSMUST00000078778
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148
AA Change: N84Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102894
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105481
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593
AA Change: N84Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105482
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593
AA Change: N84Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217705
Predicted Effect probably benign
Transcript: ENSMUST00000217706
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000218123
AA Change: N84Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect probably benign
Transcript: ENSMUST00000218617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219388
Predicted Effect probably benign
Transcript: ENSMUST00000219696
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219848
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220166
Predicted Effect probably benign
Transcript: ENSMUST00000220182
AA Change: N84Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000220226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220402
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased sensitivity to IgE-dependent passive cutaneous anaphylaxis and a reduced threshold for antigen challenge in active cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Lilrb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Lilrb4a APN 10 51494065 missense probably benign 0.42
IGL02057:Lilrb4a APN 10 51492007 missense possibly damaging 0.81
IGL02386:Lilrb4a APN 10 51491226 nonsense probably null
IGL02999:Lilrb4a APN 10 51494143 missense probably damaging 1.00
IGL03292:Lilrb4a APN 10 51494846 unclassified probably null
IGL03382:Lilrb4a APN 10 51491520 missense probably benign 0.10
R0276:Lilrb4a UTSW 10 51491581 missense probably benign 0.01
R0470:Lilrb4a UTSW 10 51494827 missense possibly damaging 0.87
R1459:Lilrb4a UTSW 10 51491587 missense probably benign 0.44
R1675:Lilrb4a UTSW 10 51496185 missense probably benign 0.37
R1819:Lilrb4a UTSW 10 51496028 missense probably damaging 1.00
R1914:Lilrb4a UTSW 10 51491949 missense probably benign 0.04
R2265:Lilrb4a UTSW 10 51491537 nonsense probably null
R2338:Lilrb4a UTSW 10 51491700 missense probably benign 0.13
R2886:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R4322:Lilrb4a UTSW 10 51491611 missense probably damaging 1.00
R4624:Lilrb4a UTSW 10 51491488 missense probably damaging 1.00
R4923:Lilrb4a UTSW 10 51492043 missense possibly damaging 0.67
R5001:Lilrb4a UTSW 10 51491420 splice site probably null
R5262:Lilrb4a UTSW 10 51493207 critical splice donor site probably null
R6224:Lilrb4a UTSW 10 51491649 missense probably damaging 1.00
R7447:Lilrb4a UTSW 10 51491053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGAAGATGTTCAGGGCCTTTG -3'
(R):5'- TGGACTCTGAGAGAAGAGCTC -3'

Sequencing Primer
(F):5'- GGGCCTTTGATTTCTTCACAGGAC -3'
(R):5'- CCTGGAAAATAGATCTCCTTCTGAGG -3'
Posted On2015-01-23