Incidental Mutation 'R2884:Vmn2r82'
ID260971
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79396248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 694 (I694V)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect probably benign
Transcript: ENSMUST00000170596
AA Change: I694V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: I694V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Meta Mutation Damage Score 0.1428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79378800 missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79396557 missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79379419 missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79379037 missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTCCAATTATAAAGGCC -3'
(R):5'- ATGACTCCCAGGTAAGCCAG -3'

Sequencing Primer
(F):5'- GGCCAATAATAGATCCCTCAGTTAC -3'
(R):5'- TCCCAGGTAAGCCAGAGTGC -3'
Posted On2015-01-23