Incidental Mutation 'R2884:Dnmt3a'
ID260978
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene NameDNA methyltransferase 3A
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3806007-3914443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3896132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 329 (D329G)
Ref Sequence ENSEMBL: ENSMUSP00000134009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000111186] [ENSMUST00000172509] [ENSMUST00000172689] [ENSMUST00000172879] [ENSMUST00000174102] [ENSMUST00000174483] [ENSMUST00000174774] [ENSMUST00000174817]
Predicted Effect probably damaging
Transcript: ENSMUST00000020991
AA Change: D329G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661
AA Change: D329G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111186
AA Change: D110G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106817
Gene: ENSMUSG00000020661
AA Change: D110G

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172509
AA Change: D255G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133869
Gene: ENSMUSG00000020661
AA Change: D255G

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
PWWP 212 270 1.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172689
AA Change: D110G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133543
Gene: ENSMUSG00000020661
AA Change: D110G

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172749
AA Change: D103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134567
Gene: ENSMUSG00000020661
AA Change: D103G

DomainStartEndE-ValueType
PWWP 61 119 7.62e-19 SMART
low complexity region 151 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172879
Predicted Effect probably benign
Transcript: ENSMUST00000174102
SMART Domains Protein: ENSMUSP00000134480
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
Pfam:PWWP 101 140 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174272
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174733
SMART Domains Protein: ENSMUSP00000134492
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
Pfam:DNA_methylase 16 104 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174774
AA Change: D110G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134529
Gene: ENSMUSG00000020661
AA Change: D110G

DomainStartEndE-ValueType
PWWP 67 125 1.36e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174817
AA Change: D329G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661
AA Change: D329G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3905622 missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3872886 splice site probably benign
IGL02815:Dnmt3a APN 12 3904226 critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3902666 missense probably damaging 1.00
R0028:Dnmt3a UTSW 12 3900337 missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R0843:Dnmt3a UTSW 12 3872886 splice site probably benign
R1055:Dnmt3a UTSW 12 3872864 missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3901660 missense probably damaging 0.99
R1680:Dnmt3a UTSW 12 3873361 missense probably damaging 0.97
R1753:Dnmt3a UTSW 12 3873342 missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3872859 missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3849654 utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3897551 splice site probably null
R2359:Dnmt3a UTSW 12 3901599 missense probably damaging 1.00
R2384:Dnmt3a UTSW 12 3901591 missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3899883 missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3849626 splice site probably null
R4281:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4809:Dnmt3a UTSW 12 3900352 missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3896008 missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3895643 missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3899615 missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3885660 splice site probably null
R5928:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3902399 missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3907623 missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3897406 missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3897600 missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3897591 missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3872844 missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3902397 missense probably damaging 1.00
R7239:Dnmt3a UTSW 12 3872850 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTTAGGACTGCTGTGTATTGAC -3'
(R):5'- AGTCACTGGACCCTTGCTTG -3'

Sequencing Primer
(F):5'- ACTGCTGTGTATTGACTTTTGCTC -3'
(R):5'- TAGCAAGAGGGGCCCAGATC -3'
Posted On2015-01-23