Incidental Mutation 'R2884:Ppp4r3a'
ID260982
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Nameprotein phosphatase 4 regulatory subunit 3A
Synonyms1110034C04Rik, Smek1
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101039409-101083702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101068677 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 53 (E53G)
Ref Sequence ENSEMBL: ENSMUSP00000041667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095]
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: E53G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: E53G

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163095
AA Change: E53G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: E53G

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223161
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101049794 missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101044653 missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101058496 missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101041835 missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101042511 missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101058323 critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101049654 splice site probably benign
IGL03206:Ppp4r3a APN 12 101058619 missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101051571 missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101043524 missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101040741 missense probably damaging 0.99
R1554:Ppp4r3a UTSW 12 101055822 missense probably damaging 1.00
R1650:Ppp4r3a UTSW 12 101044619 missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101058482 missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101042567 missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101042619 missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2422:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2859:Ppp4r3a UTSW 12 101042647 critical splice acceptor site probably null
R4157:Ppp4r3a UTSW 12 101055619 missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101041916 missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101082767 missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101053566 missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101043470 missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101043521 missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101083360 utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101058511 missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101051613 missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101043579 missense probably benign
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101049776 missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101053511 missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101041832 missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101058794 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTGATACCCAAGTCTAATACCCAG -3'
(R):5'- GGCATGTAGAGATAGCTTTCAGG -3'

Sequencing Primer
(F):5'- AAGTTGTTCTCTGACCTCAACAGG -3'
(R):5'- TCAAGTCATCAAGCTCTTGCAAAG -3'
Posted On2015-01-23