Incidental Mutation 'R2885:Cyp4b1'
ID261003
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115635652 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 287 (D287N)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably damaging
Transcript: ENSMUST00000102707
AA Change: D287N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: D287N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135569
AA Change: D163N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143237
Predicted Effect unknown
Transcript: ENSMUST00000145841
AA Change: D211N
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: D211N

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0143:Cyp4b1 UTSW 4 115635874 missense probably damaging 0.99
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0725:Cyp4b1 UTSW 4 115626827 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1084:Cyp4b1 UTSW 4 115640312 missense probably benign 0.00
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2279:Cyp4b1 UTSW 4 115640360 missense probably benign 0.23
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGTGATCCAGACTGCCAG -3'
(R):5'- TCATTCCTCCACTCCAGGTAGG -3'

Sequencing Primer
(F):5'- GATCCAGACTGCCAGTTCCCTAATG -3'
(R):5'- CCAGGTAGGAAGCCTTTGTTATTCC -3'
Posted On2015-01-23