Incidental Mutation 'R2885:Vmn2r60'
ID261006
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42140979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 463 (D463E)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166447
AA Change: D463E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: D463E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACATGGCTGTTTCAAATG -3'
(R):5'- GTTTAATGGTCATGACATCCTGAG -3'

Sequencing Primer
(F):5'- GGACATGGCTGTTTCAAATGAGATTC -3'
(R):5'- GGTCATGACATCCTGAGAATTACC -3'
Posted On2015-01-23