Incidental Mutation 'R2885:Cmip'
ID261010
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Namec-Maf inducing protein
Synonyms
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117257064-117459430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117384965 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 145 (N145S)
Ref Sequence ENSEMBL: ENSMUSP00000130264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095172] [ENSMUST00000166750]
Predicted Effect probably benign
Transcript: ENSMUST00000095172
AA Change: N57S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092795
Gene: ENSMUSG00000034390
AA Change: N57S

DomainStartEndE-ValueType
Blast:PH 13 70 5e-33 BLAST
low complexity region 71 79 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
SCOP:d1a9na_ 564 681 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166750
AA Change: N145S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: N145S

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211913
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 117445328 missense probably benign 0.29
IGL02126:Cmip APN 8 117449031 missense probably damaging 0.99
IGL02205:Cmip APN 8 117454975 missense probably damaging 1.00
IGL02352:Cmip APN 8 117411255 splice site probably benign
IGL02359:Cmip APN 8 117411255 splice site probably benign
IGL02558:Cmip APN 8 117449088 missense probably damaging 0.99
R0070:Cmip UTSW 8 117426554 missense probably damaging 0.99
R0335:Cmip UTSW 8 117445366 missense probably damaging 0.99
R1225:Cmip UTSW 8 117445371 missense probably damaging 0.98
R1561:Cmip UTSW 8 117453850 missense probably benign 0.41
R2508:Cmip UTSW 8 117436693 missense probably benign
R3415:Cmip UTSW 8 117349377 critical splice donor site probably null
R4024:Cmip UTSW 8 117447416 missense possibly damaging 0.79
R4168:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4169:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4632:Cmip UTSW 8 117447411 missense possibly damaging 0.88
R4706:Cmip UTSW 8 117377154 missense probably damaging 0.99
R4924:Cmip UTSW 8 117257255 missense probably benign 0.00
R5380:Cmip UTSW 8 117422890 missense probably damaging 0.99
R5927:Cmip UTSW 8 117257309 missense possibly damaging 0.85
R6212:Cmip UTSW 8 117377156 missense probably damaging 1.00
R6310:Cmip UTSW 8 117429810 missense possibly damaging 0.63
R6747:Cmip UTSW 8 117436879 missense probably benign 0.02
R6881:Cmip UTSW 8 117436595 missense possibly damaging 0.77
R6968:Cmip UTSW 8 117377156 missense probably damaging 1.00
R7003:Cmip UTSW 8 117384988 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTAGGGACTCTATTATACCCAGC -3'
(R):5'- TCAGAAGGCACAACCCTTGG -3'

Sequencing Primer
(F):5'- CATACCATCAACCATGTCTTCTG -3'
(R):5'- CCTTGGGGAGAGAGTAGAAGCTTC -3'
Posted On2015-01-23