Incidental Mutation 'R2885:Mapk1'
ID261030
Institutional Source Beutler Lab
Gene Symbol Mapk1
Ensembl Gene ENSMUSG00000063358
Gene Namemitogen-activated protein kinase 1
SynonymsPrkm1, p42mapk, 9030612K14Rik, MAPK2, Erk2
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16983382-17047453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17026445 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 269 (N269S)
Ref Sequence ENSEMBL: ENSMUSP00000156154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023462] [ENSMUST00000069107] [ENSMUST00000115731] [ENSMUST00000129477] [ENSMUST00000232067] [ENSMUST00000232611]
Predicted Effect probably benign
Transcript: ENSMUST00000023462
AA Change: N269S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023462
Gene: ENSMUSG00000063358
AA Change: N269S

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069107
AA Change: N269S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065983
Gene: ENSMUSG00000063358
AA Change: N269S

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115731
AA Change: N269S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111396
Gene: ENSMUSG00000063358
AA Change: N269S

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129477
AA Change: N27S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115125
Gene: ENSMUSG00000063358
AA Change: N27S

DomainStartEndE-ValueType
Pfam:Pkinase 2 69 1.3e-5 PFAM
low complexity region 106 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231420
Predicted Effect probably benign
Transcript: ENSMUST00000231821
Predicted Effect probably benign
Transcript: ENSMUST00000232067
AA Change: N27S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232281
Predicted Effect probably benign
Transcript: ENSMUST00000232611
AA Change: N269S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutant embryos implant in the uterus, but die shortly thereafter failing to form extraembryonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Mapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Mapk1 APN 16 17035458 missense probably benign 0.00
IGL01486:Mapk1 APN 16 17018280 splice site probably benign
IGL01764:Mapk1 APN 16 16983733 missense possibly damaging 0.50
IGL02138:Mapk1 APN 16 17023452 missense probably benign 0.18
IGL02701:Mapk1 APN 16 17015906 missense probably benign 0.00
R0517:Mapk1 UTSW 16 17016046 missense probably benign 0.02
R1609:Mapk1 UTSW 16 17038306 splice site probably benign
R1862:Mapk1 UTSW 16 17026429 missense probably benign 0.36
R4205:Mapk1 UTSW 16 17038457 intron probably benign
R4959:Mapk1 UTSW 16 17018306 missense probably damaging 1.00
R5694:Mapk1 UTSW 16 17018469 missense probably benign 0.02
R6630:Mapk1 UTSW 16 17026385 missense probably damaging 1.00
R6809:Mapk1 UTSW 16 17035462 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGCTCACTCTAGCATGGTTG -3'
(R):5'- AATGAACCAGCTTTCCAGTCTAAC -3'

Sequencing Primer
(F):5'- TGCTTTGTTTTGTTTTCATGTTCTC -3'
(R):5'- TTTCAAGCTGGAGCCTGA -3'
Posted On2015-01-23