Incidental Mutation 'R2885:Ift57'
ID261031
Institutional Source Beutler Lab
Gene Symbol Ift57
Ensembl Gene ENSMUSG00000032965
Gene Nameintraflagellar transport 57
Synonyms4833420A15Rik, MHS4R2, HIPPI, Esrrbl1
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location49699233-49765126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49763751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 289 (V289A)
Ref Sequence ENSEMBL: ENSMUSP00000117882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046777] [ENSMUST00000142682]
Predicted Effect probably damaging
Transcript: ENSMUST00000046777
AA Change: V374A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046645
Gene: ENSMUSG00000032965
AA Change: V374A

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:IFT57 44 401 2.1e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127115
Predicted Effect unknown
Transcript: ENSMUST00000140914
AA Change: V245A
SMART Domains Protein: ENSMUSP00000116412
Gene: ENSMUSG00000032965
AA Change: V245A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:IFT57 48 273 6.4e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142682
AA Change: V289A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117882
Gene: ENSMUSG00000032965
AA Change: V289A

DomainStartEndE-ValueType
Pfam:IFT57 1 272 5.5e-111 PFAM
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, abnormal left-right axis patterning, absence of embryonic cilia. random and delayed embryo turning, and abnormal neural tube development and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Ift57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Ift57 APN 16 49763889 missense probably benign 0.39
R0636:Ift57 UTSW 16 49711896 missense probably benign 0.27
R1552:Ift57 UTSW 16 49759353 missense probably benign 0.09
R2172:Ift57 UTSW 16 49759340 missense probably benign 0.03
R4657:Ift57 UTSW 16 49762594 splice site probably null
R4761:Ift57 UTSW 16 49701900 missense probably damaging 1.00
R5726:Ift57 UTSW 16 49699498 missense probably damaging 1.00
R5958:Ift57 UTSW 16 49711108 intron probably benign
R6013:Ift57 UTSW 16 49699304 utr 5 prime probably null
R6189:Ift57 UTSW 16 49763813 missense probably damaging 1.00
R6390:Ift57 UTSW 16 49762473 intron probably null
R6749:Ift57 UTSW 16 49760984 missense probably benign 0.23
R6862:Ift57 UTSW 16 49763804 missense possibly damaging 0.49
R7073:Ift57 UTSW 16 49763867 missense probably benign 0.10
R7379:Ift57 UTSW 16 49760994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACATCAAACATTGAACCAGTTCC -3'
(R):5'- ATAATCAGAAGCATGGAAGCCC -3'

Sequencing Primer
(F):5'- ACTCTCAGGTGTTTAAAATACCACCG -3'
(R):5'- GCCCACGTGTTTAATAGAAGC -3'
Posted On2015-01-23