Incidental Mutation 'R2887:1810009A15Rik'
ID261093
Institutional Source Beutler Lab
Gene Symbol 1810009A15Rik
Ensembl Gene ENSMUSG00000071653
Gene NameRIKEN cDNA 1810009A15 gene
Synonyms
MMRRC Submission 040475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2887 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8888853-8890881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8890031 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000093970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096249] [ENSMUST00000096251] [ENSMUST00000177826] [ENSMUST00000185488] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093658
Predicted Effect probably benign
Transcript: ENSMUST00000096249
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096251
AA Change: S65P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175573
Predicted Effect probably benign
Transcript: ENSMUST00000177826
SMART Domains Protein: ENSMUSP00000137432
Gene: ENSMUSG00000116166

DomainStartEndE-ValueType
Pfam:Lbh 1 101 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185488
SMART Domains Protein: ENSMUSP00000140221
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187037
Predicted Effect probably benign
Transcript: ENSMUST00000187504
AA Change: V227A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740
AA Change: V227A

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190843
Predicted Effect probably damaging
Transcript: ENSMUST00000191089
AA Change: S65P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Aurka A G 2: 172,367,120 S54P probably benign Het
Clec7a C T 6: 129,470,997 G35E probably damaging Het
Clock G A 5: 76,245,273 R239C probably damaging Het
Eefsec T C 6: 88,258,359 T214A probably benign Het
Emg1 T C 6: 124,705,063 H166R probably damaging Het
Fibin T A 2: 110,362,777 I7F probably benign Het
Golm1 G T 13: 59,640,230 T285K probably benign Het
Ivl C A 3: 92,571,392 R455S unknown Het
Lama4 A C 10: 39,092,254 Q1464P possibly damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Olfr61 A T 7: 140,638,225 I175F probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Ptprc A G 1: 138,080,178 V711A probably damaging Het
Rimklb T C 6: 122,472,698 T6A probably benign Het
Serpina3c T C 12: 104,147,290 H399R probably benign Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Slc7a13 A G 4: 19,819,052 Y84C possibly damaging Het
Tcf7l1 G A 6: 72,632,088 S297L probably damaging Het
Vmn2r98 G T 17: 19,081,177 A814S possibly damaging Het
Zfp14 G T 7: 30,038,765 T265K probably damaging Het
Other mutations in 1810009A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0948:1810009A15Rik UTSW 19 8890026 missense probably damaging 1.00
R0960:1810009A15Rik UTSW 19 8890428 missense probably benign
R1412:1810009A15Rik UTSW 19 8889995 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAGCCCATTCAGTAATTTG -3'
(R):5'- GGGCTTCCACTGAACAAAAGG -3'

Sequencing Primer
(F):5'- CCCATTTAAATTCCAGTGCCAGGAG -3'
(R):5'- CAAAAATCTGATGCCCTCTTCTGGAG -3'
Posted On2015-01-23