Incidental Mutation 'R2908:Atp1a4'
ID261096
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene NameATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172223513-172258414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172234477 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 694 (Y694H)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
Predicted Effect probably benign
Transcript: ENSMUST00000111243
AA Change: Y694H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: Y694H

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172240164 missense probably benign
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172234431 missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172227170 missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172244408 missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTTCAAGATGGGATTCCCTCC -3'
(R):5'- GTCAATCTGAGGACAGCACAC -3'

Sequencing Primer
(F):5'- AGATGGGATTCCCTCCAGTAC -3'
(R):5'- TCTGAGGACAGCACACACTGG -3'
Posted On2015-01-23