Incidental Mutation 'R2908:Pbx3'
ID261097
Institutional Source Beutler Lab
Gene Symbol Pbx3
Ensembl Gene ENSMUSG00000038718
Gene Namepre B cell leukemia homeobox 3
Synonyms
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34171457-34373142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34172921 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 422 (T422K)
Ref Sequence ENSEMBL: ENSMUSP00000045281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040638] [ENSMUST00000113132] [ENSMUST00000143776] [ENSMUST00000153278]
Predicted Effect probably damaging
Transcript: ENSMUST00000040638
AA Change: T422K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045281
Gene: ENSMUSG00000038718
AA Change: T422K

DomainStartEndE-ValueType
Pfam:PBC 43 234 2.7e-97 PFAM
HOX 235 300 1.74e-17 SMART
low complexity region 308 341 N/A INTRINSIC
Blast:HOX 342 385 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113132
SMART Domains Protein: ENSMUSP00000108757
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 234 8.5e-103 PFAM
HOX 235 300 8.8e-20 SMART
low complexity region 308 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143776
SMART Domains Protein: ENSMUSP00000119914
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153278
SMART Domains Protein: ENSMUSP00000123567
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175855
SMART Domains Protein: ENSMUSP00000135838
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 1 53 1.6e-27 PFAM
HOX 54 119 8.8e-20 SMART
low complexity region 127 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176213
SMART Domains Protein: ENSMUSP00000135702
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 2 145 3.2e-76 PFAM
HOX 146 211 1.74e-17 SMART
low complexity region 219 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with hypoventilation and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Pbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02468:Pbx3 APN 2 34224577 missense probably damaging 1.00
IGL02524:Pbx3 APN 2 34370818 splice site probably benign
PIT4812001:Pbx3 UTSW 2 34224619 missense probably damaging 0.96
R0302:Pbx3 UTSW 2 34224560 missense probably benign 0.42
R1526:Pbx3 UTSW 2 34371764 missense probably damaging 1.00
R1529:Pbx3 UTSW 2 34204859 missense probably damaging 1.00
R1627:Pbx3 UTSW 2 34175953 missense probably benign 0.00
R1652:Pbx3 UTSW 2 34224556 missense probably damaging 1.00
R1791:Pbx3 UTSW 2 34224452 missense possibly damaging 0.95
R1850:Pbx3 UTSW 2 34176820 missense probably benign 0.34
R4073:Pbx3 UTSW 2 34224412 missense probably damaging 1.00
R5212:Pbx3 UTSW 2 34288781 intron probably benign
R5897:Pbx3 UTSW 2 34371908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGGCCTAATTGGATAAAGTGC -3'
(R):5'- CAACGTGGGTTCAGAAAATACATC -3'

Sequencing Primer
(F):5'- AAGTGCTTTCTTTTTAAACGTGTGTC -3'
(R):5'- AATACATCTTGCTAATGCGCC -3'
Posted On2015-01-23