Incidental Mutation 'R2908:Olfr1176'
ID261099
Institutional Source Beutler Lab
Gene Symbol Olfr1176
Ensembl Gene ENSMUSG00000050023
Gene Nameolfactory receptor 1176
SynonymsMOR174-5, GA_x6K02T2Q125-49824309-49825256
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88336721-88342048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88340483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 306 (I306T)
Ref Sequence ENSEMBL: ENSMUSP00000149943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057439] [ENSMUST00000137895] [ENSMUST00000213778] [ENSMUST00000216713]
Predicted Effect probably benign
Transcript: ENSMUST00000057439
AA Change: I306T

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053353
Gene: ENSMUSG00000050023
AA Change: I306T

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:7tm_4 32 309 5.3e-46 PFAM
Pfam:7tm_1 42 291 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137895
Predicted Effect probably benign
Transcript: ENSMUST00000213778
AA Change: I306T

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216713
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Olfr1176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Olfr1176 APN 2 88340427 missense probably damaging 1.00
IGL02166:Olfr1176 APN 2 88339678 missense probably damaging 0.97
IGL02340:Olfr1176 APN 2 88339562 unclassified probably benign
IGL02598:Olfr1176 APN 2 88340251 missense possibly damaging 0.64
IGL03069:Olfr1176 APN 2 88340299 unclassified probably null
IGL03212:Olfr1176 APN 2 88339672 missense probably damaging 1.00
R1959:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R1960:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R2907:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R4049:Olfr1176 UTSW 2 88343800 unclassified probably null
R4257:Olfr1176 UTSW 2 88340277 missense probably damaging 1.00
R4823:Olfr1176 UTSW 2 88339835 missense probably damaging 0.96
R4897:Olfr1176 UTSW 2 88344342 missense possibly damaging 0.89
R5106:Olfr1176 UTSW 2 88340110 missense probably benign 0.07
R5192:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5196:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5331:Olfr1176 UTSW 2 88339988 missense probably damaging 1.00
R5579:Olfr1176 UTSW 2 88340413 missense possibly damaging 0.83
R6283:Olfr1176 UTSW 2 88339658 missense probably benign 0.33
R6702:Olfr1176 UTSW 2 88340242 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAAGCCTTGTCCACCTGTG -3'
(R):5'- GGGAATTATCACCCATGTGTACTC -3'

Sequencing Primer
(F):5'- GTGCTCCACACCTGACTG -3'
(R):5'- CAGAGAACAATGATTTAACCTTCTCC -3'
Posted On2015-01-23