Incidental Mutation 'R2908:Slc25a40'
ID261102
Institutional Source Beutler Lab
Gene Symbol Slc25a40
Ensembl Gene ENSMUSG00000054099
Gene Namesolute carrier family 25, member 40
Synonyms
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8422850-8454797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8427505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 30 (T30I)
Ref Sequence ENSEMBL: ENSMUSP00000143045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002368] [ENSMUST00000066921] [ENSMUST00000168500] [ENSMUST00000170496] [ENSMUST00000171808] [ENSMUST00000196727] [ENSMUST00000198792]
Predicted Effect probably benign
Transcript: ENSMUST00000002368
SMART Domains Protein: ENSMUSP00000002368
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 287 334 7.09e-28 SMART
low complexity region 643 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066921
AA Change: T30I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067611
Gene: ENSMUSG00000054099
AA Change: T30I

DomainStartEndE-ValueType
Pfam:Mito_carr 13 137 1.5e-24 PFAM
Pfam:Mito_carr 139 229 4.6e-20 PFAM
Pfam:Mito_carr 232 333 3.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166364
Predicted Effect probably benign
Transcript: ENSMUST00000168500
SMART Domains Protein: ENSMUSP00000132985
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Pfam:BRCT 41 179 2e-7 PFAM
low complexity region 182 204 N/A INTRINSIC
PDB:4F9C|B 210 308 2e-42 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000170496
AA Change: T30I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130630
Gene: ENSMUSG00000054099
AA Change: T30I

DomainStartEndE-ValueType
Pfam:Mito_carr 13 137 5.8e-24 PFAM
Pfam:Mito_carr 141 229 1.4e-17 PFAM
Pfam:Mito_carr 232 333 2.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170927
Predicted Effect probably benign
Transcript: ENSMUST00000171808
SMART Domains Protein: ENSMUSP00000132906
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 288 335 7.09e-28 SMART
low complexity region 644 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196727
AA Change: T30I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142511
Gene: ENSMUSG00000054099
AA Change: T30I

DomainStartEndE-ValueType
Pfam:Mito_carr 13 80 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198785
Predicted Effect probably damaging
Transcript: ENSMUST00000198792
AA Change: T30I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143045
Gene: ENSMUSG00000054099
AA Change: T30I

DomainStartEndE-ValueType
Pfam:Mito_carr 13 129 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199817
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A40 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and overtly normal in a battery of physiological, metabolic, and behavioral assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Slc25a40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Slc25a40 APN 5 8453298 makesense probably null
IGL01418:Slc25a40 APN 5 8453298 makesense probably null
IGL02604:Slc25a40 APN 5 8453219 missense probably benign
IGL03371:Slc25a40 APN 5 8427442 missense probably benign 0.01
PIT4494001:Slc25a40 UTSW 5 8440737 missense probably damaging 1.00
R0443:Slc25a40 UTSW 5 8447348 missense probably benign 0.05
R1051:Slc25a40 UTSW 5 8430450 missense probably benign
R1707:Slc25a40 UTSW 5 8440793 splice site probably null
R1861:Slc25a40 UTSW 5 8442431 intron probably null
R2117:Slc25a40 UTSW 5 8430417 missense probably damaging 1.00
R2135:Slc25a40 UTSW 5 8427489 missense possibly damaging 0.78
R2567:Slc25a40 UTSW 5 8430459 missense probably damaging 1.00
R5140:Slc25a40 UTSW 5 8430486 missense probably damaging 0.96
R5269:Slc25a40 UTSW 5 8447409 critical splice donor site probably null
R6665:Slc25a40 UTSW 5 8452788 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCACACTGGCTTCCATTTATAAC -3'
(R):5'- GTTTTCCTCATGCACACGTG -3'

Sequencing Primer
(F):5'- ATGTTAGGCAAGCACTCCTG -3'
(R):5'- GTGCACAAATAACAAACATGCATATG -3'
Posted On2015-01-23