Incidental Mutation 'R2908:Rbm26'
ID261116
Institutional Source Beutler Lab
Gene Symbol Rbm26
Ensembl Gene ENSMUSG00000022119
Gene NameRNA binding motif protein 26
Synonyms1700009P03Rik, Pro1777, C230097K14Rik
MMRRC Submission 040495-MU
Accession Numbers

Genbank: NM_134077; MGI: 1921463

Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location105106751-105177327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105142834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 516 (T516S)
Ref Sequence ENSEMBL: ENSMUSP00000022715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022715] [ENSMUST00000100327] [ENSMUST00000163499] [ENSMUST00000163545]
Predicted Effect probably benign
Transcript: ENSMUST00000022715
AA Change: T516S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022715
Gene: ENSMUSG00000022119
AA Change: T516S

DomainStartEndE-ValueType
Pfam:PWI 10 80 1.1e-9 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 722 735 N/A INTRINSIC
Blast:RRM_2 753 820 6e-19 BLAST
low complexity region 848 879 N/A INTRINSIC
RRM 892 956 2.1e-1 SMART
low complexity region 970 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100327
AA Change: T516S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097901
Gene: ENSMUSG00000022119
AA Change: T516S

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.1e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 698 711 N/A INTRINSIC
Blast:RRM_2 729 796 6e-19 BLAST
low complexity region 824 855 N/A INTRINSIC
RRM 868 932 2.1e-1 SMART
low complexity region 946 978 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163499
AA Change: T521S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128197
Gene: ENSMUSG00000022119
AA Change: T521S

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.2e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 727 740 N/A INTRINSIC
Blast:RRM_2 758 825 6e-19 BLAST
low complexity region 853 884 N/A INTRINSIC
RRM 897 961 2.1e-1 SMART
low complexity region 975 983 N/A INTRINSIC
low complexity region 986 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163545
AA Change: T521S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126414
Gene: ENSMUSG00000022119
AA Change: T521S

DomainStartEndE-ValueType
Pfam:PWI 11 81 1.5e-11 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 724 737 N/A INTRINSIC
Blast:RRM_2 755 822 6e-19 BLAST
low complexity region 850 881 N/A INTRINSIC
RRM 894 958 2.1e-1 SMART
low complexity region 972 1004 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Rbm26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Rbm26 APN 14 105159960 missense unknown
IGL00948:Rbm26 APN 14 105150343 missense probably damaging 1.00
IGL01584:Rbm26 APN 14 105131532 missense probably damaging 0.99
IGL01726:Rbm26 APN 14 105152507 missense probably damaging 0.99
IGL02095:Rbm26 APN 14 105144260 missense probably damaging 1.00
IGL03306:Rbm26 APN 14 105151322 missense probably damaging 0.99
monte UTSW 14 105142834 missense probably benign 0.12
D4043:Rbm26 UTSW 14 105152540 missense possibly damaging 0.59
I0000:Rbm26 UTSW 14 105153567 missense unknown
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0243:Rbm26 UTSW 14 105131938 missense probably benign 0.22
R0738:Rbm26 UTSW 14 105176782 missense unknown
R1566:Rbm26 UTSW 14 105160544 missense unknown
R1645:Rbm26 UTSW 14 105150817 missense probably damaging 1.00
R1789:Rbm26 UTSW 14 105117073 missense probably benign 0.32
R1809:Rbm26 UTSW 14 105117106 splice site probably benign
R2144:Rbm26 UTSW 14 105115202 nonsense probably null
R2321:Rbm26 UTSW 14 105153427 missense unknown
R2495:Rbm26 UTSW 14 105151312 splice site probably benign
R2906:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2907:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R3034:Rbm26 UTSW 14 105153445 missense unknown
R3427:Rbm26 UTSW 14 105131532 missense probably damaging 0.99
R3818:Rbm26 UTSW 14 105141270 missense probably damaging 0.99
R3863:Rbm26 UTSW 14 105121068 missense probably damaging 0.99
R4448:Rbm26 UTSW 14 105151550 missense probably damaging 0.99
R5022:Rbm26 UTSW 14 105144252 missense probably damaging 1.00
R5040:Rbm26 UTSW 14 105121016 missense probably benign 0.05
R5626:Rbm26 UTSW 14 105144231 missense probably benign 0.43
R5817:Rbm26 UTSW 14 105128603 missense probably damaging 1.00
R5960:Rbm26 UTSW 14 105150315 missense probably damaging 1.00
R6318:Rbm26 UTSW 14 105131535 missense probably damaging 0.99
R6608:Rbm26 UTSW 14 105152498 missense probably damaging 1.00
R6821:Rbm26 UTSW 14 105116964 intron probably benign
R7075:Rbm26 UTSW 14 105160607 missense unknown
R7136:Rbm26 UTSW 14 105144267 missense possibly damaging 0.88
R7340:Rbm26 UTSW 14 105152540 missense possibly damaging 0.86
R7431:Rbm26 UTSW 14 105117092 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCTAACGCAATGTCCAACTTCC -3'
(R):5'- GCTTCCATGAAAGATGCCAAC -3'

Sequencing Primer
(F):5'- ACTTTGTAGAACAGGCTGACCTCG -3'
(R):5'- GCCAACACTACTAATTTGGAAACTG -3'
Posted On2015-01-23