Incidental Mutation 'R2908:Zfp53'
ID261119
Institutional Source Beutler Lab
Gene Symbol Zfp53
Ensembl Gene ENSMUSG00000057409
Gene Namezinc finger protein 53
SynonymsZfp-53, KRAZ1, Zfp118, zfas8, D030067O06Rik
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21491256-21509764 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 21508474 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 256 (C256*)
Ref Sequence ENSEMBL: ENSMUSP00000075960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076664]
Predicted Effect probably null
Transcript: ENSMUST00000076664
AA Change: C256*
SMART Domains Protein: ENSMUSP00000075960
Gene: ENSMUSG00000057409
AA Change: C256*

DomainStartEndE-ValueType
KRAB 54 114 6.06e-23 SMART
ZnF_C2H2 226 248 1.18e-2 SMART
ZnF_C2H2 254 276 1.28e-3 SMART
ZnF_C2H2 282 304 2.65e-5 SMART
ZnF_C2H2 310 332 9.58e-3 SMART
ZnF_C2H2 338 360 2.86e-1 SMART
ZnF_C2H2 366 388 4.24e-4 SMART
ZnF_C2H2 394 416 4.87e-4 SMART
ZnF_C2H2 422 444 3.69e-4 SMART
ZnF_C2H2 450 472 6.23e-2 SMART
ZnF_C2H2 478 500 7.26e-3 SMART
ZnF_C2H2 506 528 1.72e-4 SMART
ZnF_C2H2 534 556 5.14e-3 SMART
ZnF_C2H2 562 584 9.08e-4 SMART
ZnF_C2H2 590 612 3.89e-3 SMART
ZnF_C2H2 618 640 4.87e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus results in pigmentation abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Other mutations in Zfp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zfp53 APN 17 21508338 missense probably benign
IGL00862:Zfp53 APN 17 21509098 missense probably benign 0.04
IGL01651:Zfp53 APN 17 21508086 missense probably benign 0.19
IGL02183:Zfp53 APN 17 21500250 missense possibly damaging 0.51
R0063:Zfp53 UTSW 17 21508105 missense probably benign 0.19
R0449:Zfp53 UTSW 17 21508833 missense probably benign 0.17
R0514:Zfp53 UTSW 17 21509009 missense probably damaging 1.00
R0755:Zfp53 UTSW 17 21508577 missense probably damaging 1.00
R1661:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1665:Zfp53 UTSW 17 21509504 missense probably damaging 1.00
R1693:Zfp53 UTSW 17 21509622 missense possibly damaging 0.60
R2113:Zfp53 UTSW 17 21508451 missense probably benign 0.19
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2869:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2870:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2871:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2873:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R2874:Zfp53 UTSW 17 21508078 missense probably benign 0.00
R3873:Zfp53 UTSW 17 21508631 missense probably damaging 0.98
R4499:Zfp53 UTSW 17 21509235 missense probably damaging 0.96
R4806:Zfp53 UTSW 17 21505001 missense possibly damaging 0.91
R5007:Zfp53 UTSW 17 21509510 missense probably benign 0.15
R6261:Zfp53 UTSW 17 21508713 missense possibly damaging 0.90
R6329:Zfp53 UTSW 17 21508110 missense probably benign 0.01
R6452:Zfp53 UTSW 17 21509613 missense probably damaging 1.00
R6899:Zfp53 UTSW 17 21508445 missense possibly damaging 0.62
R7033:Zfp53 UTSW 17 21500246 missense probably benign 0.05
R7250:Zfp53 UTSW 17 21509578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGACTCTATGCTGCAAAC -3'
(R):5'- ACAGTGGGCAAAGGATTTGTC -3'

Sequencing Primer
(F):5'- GAGACTCTATGCTGCAAACAAACTG -3'
(R):5'- GGCAAAGGATTTGTCACACTC -3'
Posted On2015-01-23