Incidental Mutation 'R2909:Plbd1'
ID261137
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136634574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 235 (V235D)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032336]
Predicted Effect probably damaging
Transcript: ENSMUST00000032336
AA Change: V235D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: V235D

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137139
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1019:Plbd1 UTSW 6 136651905 missense probably benign 0.03
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R4494:Plbd1 UTSW 6 136613858 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6842:Plbd1 UTSW 6 136635614 missense probably benign 0.05
R6938:Plbd1 UTSW 6 136616987 missense probably benign 0.00
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGACTGTACCCCACCTG -3'
(R):5'- GCCCTTGGCTATATCTTCCAATAG -3'

Sequencing Primer
(F):5'- TCCAGCTAACTTCGGATTACCAATG -3'
(R):5'- CACTCATCGGGTAAAAGGCTCTTG -3'
Posted On2015-01-23