Incidental Mutation 'R2909:Rsl24d1'
ID261143
Institutional Source Beutler Lab
Gene Symbol Rsl24d1
Ensembl Gene ENSMUSG00000032215
Gene Nameribosomal L24 domain containing 1
Synonyms2410159K22Rik
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73113426-73123333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73122303 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 61 (L61S)
Ref Sequence ENSEMBL: ENSMUSP00000129528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034738] [ENSMUST00000113505] [ENSMUST00000165177] [ENSMUST00000169399] [ENSMUST00000174203]
Predicted Effect probably benign
Transcript: ENSMUST00000034738
AA Change: L153S

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034738
Gene: ENSMUSG00000032215
AA Change: L153S

DomainStartEndE-ValueType
TRASH 6 44 1.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113505
Predicted Effect probably benign
Transcript: ENSMUST00000165177
AA Change: L154S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126553
Gene: ENSMUSG00000032215
AA Change: L154S

DomainStartEndE-ValueType
Pfam:Ribosomal_L24e 18 67 1.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169399
AA Change: L61S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000174203
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein sharing a low level of sequence similarity with human ribosomal protein L24. Although this gene has been referred to as RPL24, L30, and 60S ribosomal protein L30 isolog in the sequence databases, it is distinct from the human genes officially named RPL24 (which itself has been referred to as ribosomal protein L30) and RPL30. The protein encoded by this gene localizes to the nucleolus and is thought to play a role in the biogenesis of the 60S ribosomal subunit. The precise function of this gene is currently unknown. This gene utilizes alternative polyadenylation signals and has multiple pseudogenes. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Rsl24d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03296:Rsl24d1 APN 9 73117947 critical splice donor site probably null
R1953:Rsl24d1 UTSW 9 73114614 intron probably benign
R5320:Rsl24d1 UTSW 9 73116416 missense possibly damaging 0.47
R6602:Rsl24d1 UTSW 9 73113510 missense possibly damaging 0.86
R6701:Rsl24d1 UTSW 9 73114997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGGGATGCGTTGTAGAATAC -3'
(R):5'- TGAGCTGAGACCTAACACCC -3'

Sequencing Primer
(F):5'- CTGGACTCAGTTCTGCAGAG -3'
(R):5'- CCACAAGGGGATGCTTTTACAG -3'
Posted On2015-01-23