Incidental Mutation 'R2909:AF529169'
ID261144
Institutional Source Beutler Lab
Gene Symbol AF529169
Ensembl Gene ENSMUSG00000039313
Gene NamecDNA sequence AF529169
SynonymsDD1
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89587216-89623125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89591278 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 860 (N860S)
Ref Sequence ENSEMBL: ENSMUSP00000046111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044491] [ENSMUST00000191465]
Predicted Effect probably damaging
Transcript: ENSMUST00000044491
AA Change: N860S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046111
Gene: ENSMUSG00000039313
AA Change: N860S

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 760 915 8.7e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191465
SMART Domains Protein: ENSMUSP00000140942
Gene: ENSMUSG00000039313

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 759 854 6.1e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in AF529169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:AF529169 APN 9 89601800 missense probably benign 0.02
IGL00163:AF529169 APN 9 89591097 unclassified probably benign
IGL00336:AF529169 APN 9 89603143 missense probably damaging 1.00
IGL01608:AF529169 APN 9 89596498 missense probably benign 0.15
IGL01818:AF529169 APN 9 89601313 missense probably damaging 0.99
IGL02012:AF529169 APN 9 89601438 missense probably benign 0.01
IGL02259:AF529169 APN 9 89602359 missense possibly damaging 0.93
IGL02894:AF529169 APN 9 89603102 missense probably damaging 0.99
IGL03008:AF529169 APN 9 89596678 missense probably damaging 1.00
IGL02988:AF529169 UTSW 9 89602739 missense probably benign 0.02
R0410:AF529169 UTSW 9 89602203 missense probably damaging 0.97
R0825:AF529169 UTSW 9 89603279 nonsense probably null
R0883:AF529169 UTSW 9 89602417 missense probably benign 0.05
R0989:AF529169 UTSW 9 89602035 missense probably damaging 0.99
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1632:AF529169 UTSW 9 89602360 missense probably damaging 0.96
R1804:AF529169 UTSW 9 89603099 missense possibly damaging 0.91
R1974:AF529169 UTSW 9 89601203 missense probably damaging 1.00
R2151:AF529169 UTSW 9 89602168 missense possibly damaging 0.53
R2882:AF529169 UTSW 9 89602802 missense possibly damaging 0.86
R3961:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3962:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3963:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R4676:AF529169 UTSW 9 89601553 missense probably damaging 1.00
R4778:AF529169 UTSW 9 89603102 missense probably damaging 1.00
R4931:AF529169 UTSW 9 89601652 missense probably benign 0.05
R5300:AF529169 UTSW 9 89603199 missense probably damaging 1.00
R5702:AF529169 UTSW 9 89591155 missense probably benign 0.22
R5759:AF529169 UTSW 9 89601072 missense probably benign 0.01
R6187:AF529169 UTSW 9 89591167 missense probably damaging 1.00
R7320:AF529169 UTSW 9 89601626 missense probably benign
R7542:AF529169 UTSW 9 89601911 missense probably damaging 1.00
R7552:AF529169 UTSW 9 89601835 missense probably benign 0.00
U24488:AF529169 UTSW 9 89603047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTTCATCGTGCAGATTGG -3'
(R):5'- CAGTTTTAGTGAGGGAGGAGCC -3'

Sequencing Primer
(F):5'- TGGCACAACAATGACAAGAATGAC -3'
(R):5'- AATGGGTCCCAGGCAGC -3'
Posted On2015-01-23