Incidental Mutation 'R2909:Gm3604'
ID261151
Institutional Source Beutler Lab
Gene Symbol Gm3604
Ensembl Gene ENSMUSG00000094942
Gene Namepredicted gene 3604
Synonyms
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2909 (G1)
Quality Score208
Status Not validated
Chromosome13
Chromosomal Location62368328-62383177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 62369018 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 509 (H509D)
Ref Sequence ENSEMBL: ENSMUSP00000139845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107989] [ENSMUST00000187656] [ENSMUST00000202194]
Predicted Effect probably benign
Transcript: ENSMUST00000107989
AA Change: H508D

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103623
Gene: ENSMUSG00000094942
AA Change: H508D

DomainStartEndE-ValueType
KRAB 3 65 4.49e-17 SMART
ZnF_C2H2 132 154 2.71e-2 SMART
ZnF_C2H2 160 182 1.3e-4 SMART
ZnF_C2H2 188 210 5.21e-4 SMART
ZnF_C2H2 216 238 1.82e-3 SMART
ZnF_C2H2 244 266 7.78e-3 SMART
ZnF_C2H2 272 294 3.69e-4 SMART
ZnF_C2H2 300 322 3.95e-4 SMART
ZnF_C2H2 328 350 9.08e-4 SMART
ZnF_C2H2 356 378 1.45e-2 SMART
ZnF_C2H2 384 406 1.92e-2 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 1.4e-4 SMART
ZnF_C2H2 496 518 3.95e-4 SMART
ZnF_C2H2 524 546 2.29e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187656
AA Change: H509D

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139845
Gene: ENSMUSG00000094942
AA Change: H509D

DomainStartEndE-ValueType
KRAB 4 66 1.9e-19 SMART
ZnF_C2H2 133 155 1.2e-4 SMART
ZnF_C2H2 161 183 5.5e-7 SMART
ZnF_C2H2 189 211 2.3e-6 SMART
ZnF_C2H2 217 239 7.5e-6 SMART
ZnF_C2H2 245 267 3.4e-5 SMART
ZnF_C2H2 273 295 1.5e-6 SMART
ZnF_C2H2 301 323 1.7e-6 SMART
ZnF_C2H2 329 351 3.7e-6 SMART
ZnF_C2H2 357 379 6.3e-5 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 5.5e-7 SMART
ZnF_C2H2 441 463 2e-6 SMART
ZnF_C2H2 469 491 5.8e-7 SMART
ZnF_C2H2 497 519 1.6e-6 SMART
ZnF_C2H2 525 547 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202194
SMART Domains Protein: ENSMUSP00000144048
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 4 65 1.2e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Gm3604
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gm3604 APN 13 62370140 missense probably damaging 1.00
IGL02601:Gm3604 APN 13 62370176 missense possibly damaging 0.79
IGL03386:Gm3604 APN 13 62370167 missense possibly damaging 0.95
R1539:Gm3604 UTSW 13 62371600 missense possibly damaging 0.70
R1771:Gm3604 UTSW 13 62370074 nonsense probably null
R1776:Gm3604 UTSW 13 62370074 nonsense probably null
R1919:Gm3604 UTSW 13 62369942 missense probably benign 0.02
R1954:Gm3604 UTSW 13 62369211 missense probably damaging 0.97
R2093:Gm3604 UTSW 13 62369606 missense possibly damaging 0.50
R2291:Gm3604 UTSW 13 62371843 missense probably damaging 0.99
R3195:Gm3604 UTSW 13 62370054 nonsense probably null
R3196:Gm3604 UTSW 13 62370054 nonsense probably null
R3924:Gm3604 UTSW 13 62370230 missense probably damaging 0.99
R4328:Gm3604 UTSW 13 62369265 missense possibly damaging 0.88
R4543:Gm3604 UTSW 13 62370156 missense probably benign
R4830:Gm3604 UTSW 13 62369043 missense probably damaging 0.98
R5129:Gm3604 UTSW 13 62369774 missense probably benign 0.00
R5496:Gm3604 UTSW 13 62371579 missense possibly damaging 0.85
R6184:Gm3604 UTSW 13 62371845 missense probably damaging 1.00
R6426:Gm3604 UTSW 13 62369622 missense probably damaging 1.00
R6925:Gm3604 UTSW 13 62369390 missense probably benign 0.16
R7080:Gm3604 UTSW 13 62370295 missense probably damaging 1.00
R7182:Gm3604 UTSW 13 62371875 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTGCTCACAATGAAATTCC -3'
(R):5'- GGAGAGAAACCCTACAAATGTAATC -3'

Sequencing Primer
(F):5'- GCTCACAATGAAATTCCTTCGTAG -3'
(R):5'- AGCTTTTTCAAGACACAGTACTC -3'
Posted On2015-01-23