Incidental Mutation 'R2909:Kbtbd7'
ID261153
Institutional Source Beutler Lab
Gene Symbol Kbtbd7
Ensembl Gene ENSMUSG00000043881
Gene Namekelch repeat and BTB (POZ) domain containing 7
Synonyms1110008P08Rik, LOC211255
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2909 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79426511-79431036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79428482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 585 (T585A)
Ref Sequence ENSEMBL: ENSMUSP00000060768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
Predicted Effect probably benign
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061222
AA Change: T585A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881
AA Change: T585A

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator, having been shown to increase the transcription of activator protein-1 and serum response element. The encoded protein can also form a complex with KBTBD6 and CUL3, which regulates the ubiquitylation and degradation of TIAM1, which is a regulator of RAC1. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Chrm3 G T 13: 9,877,997 D334E probably benign Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Kbtbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Kbtbd7 APN 14 79428612 missense probably damaging 0.98
IGL01364:Kbtbd7 APN 14 79428046 missense possibly damaging 0.82
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0974:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R1236:Kbtbd7 UTSW 14 79427832 missense probably benign 0.05
R4731:Kbtbd7 UTSW 14 79428800 makesense probably null
R4732:Kbtbd7 UTSW 14 79428800 makesense probably null
R4733:Kbtbd7 UTSW 14 79428800 makesense probably null
R4984:Kbtbd7 UTSW 14 79427162 missense probably damaging 1.00
R5712:Kbtbd7 UTSW 14 79428765 missense possibly damaging 0.86
R6699:Kbtbd7 UTSW 14 79428192 missense probably benign 0.31
R7122:Kbtbd7 UTSW 14 79428317 missense probably damaging 0.98
R7176:Kbtbd7 UTSW 14 79427754 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACGAAGTGACTTTCAAGAAGCC -3'
(R):5'- CCATTCAGTGCTAGACTCACTC -3'

Sequencing Primer
(F):5'- GACTTTCAAGAAGCCTGTGTC -3'
(R):5'- GCATCATCTTCCTCAGTGATGAAAC -3'
Posted On2015-01-23