Incidental Mutation 'R0334:Ctsc'
ID26121
Institutional Source Beutler Lab
Gene Symbol Ctsc
Ensembl Gene ENSMUSG00000030560
Gene Namecathepsin C
SynonymsDPPI, dipeptidylpeptidase 1, DPP1
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0334 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location88278085-88310888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88278342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 47 (S47I)
Ref Sequence ENSEMBL: ENSMUSP00000147006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032779] [ENSMUST00000128791] [ENSMUST00000131108]
Predicted Effect probably benign
Transcript: ENSMUST00000032779
AA Change: S47I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032779
Gene: ENSMUSG00000030560
AA Change: S47I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 1.5e-48 PFAM
Pept_C1 230 457 1.05e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128791
AA Change: S47I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119503
Gene: ENSMUSG00000030560
AA Change: S47I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 7.1e-62 PFAM
SCOP:d3gcb__ 144 254 4e-8 SMART
Blast:Pept_C1 229 254 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131108
AA Change: S47I

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181565
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the dipeptidyl peptidase 1 light, heavy, and exclusion domain chains, which together comprise one subunit of the homotetrameric enzyme. This enzyme has amino dipeptidase activity and may play a role in the activation of granzymes during inflammation. Homozygous knockout mice for this gene exhibit impaired granzyme activation and enhanced survival in a sepsis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit cytotoxic lymphocytes with inactive granzymes A and B which are incapable of granule-mediated apoptosis. Mutant mast cells lack activated chymase activity. Homozygotes for other alleles display a scruffy coat with age and behavioral abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Sema3a A T 5: 13,557,301 N321I probably damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Ctsc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Ctsc APN 7 88302271 missense possibly damaging 0.78
IGL02709:Ctsc APN 7 88308139 missense probably damaging 0.99
IGL03103:Ctsc APN 7 88309805 missense probably benign
IGL03117:Ctsc APN 7 88309780 missense probably damaging 0.99
R0071:Ctsc UTSW 7 88308149 unclassified probably benign
R0587:Ctsc UTSW 7 88297229 missense probably benign 0.35
R1006:Ctsc UTSW 7 88309829 missense probably damaging 1.00
R1401:Ctsc UTSW 7 88281498 missense probably damaging 1.00
R1472:Ctsc UTSW 7 88281462 missense possibly damaging 0.88
R1602:Ctsc UTSW 7 88278304 missense possibly damaging 0.77
R1650:Ctsc UTSW 7 88281426 nonsense probably null
R1656:Ctsc UTSW 7 88281408 missense possibly damaging 0.64
R1808:Ctsc UTSW 7 88299542 missense possibly damaging 0.49
R3848:Ctsc UTSW 7 88309610 missense probably benign 0.01
R4154:Ctsc UTSW 7 88299547 missense probably benign 0.01
R4614:Ctsc UTSW 7 88278375 critical splice donor site probably null
R5313:Ctsc UTSW 7 88309553 missense probably damaging 1.00
R6863:Ctsc UTSW 7 88302278 nonsense probably null
R6949:Ctsc UTSW 7 88281458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTATTTTAAGGCGGGAGCCAC -3'
(R):5'- CAGCAGCTCAAATTCAACTTAGCGG -3'

Sequencing Primer
(F):5'- CCATCGAGTGGTGTTCCAG -3'
(R):5'- AATTCAACTTAGCGGCCCTG -3'
Posted On2013-04-16