Incidental Mutation 'R2911:Odf2l'
ID261234
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Nameouter dense fiber of sperm tails 2-like
Synonyms9630045K08Rik, 4733401D09Rik
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145118588-145153915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145124323 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 19 (I19L)
Ref Sequence ENSEMBL: ENSMUSP00000143513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192] [ENSMUST00000196552] [ENSMUST00000196857] [ENSMUST00000199124]
Predicted Effect probably benign
Transcript: ENSMUST00000029920
AA Change: I19L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: I19L

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098538
AA Change: I19L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: I19L

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098539
AA Change: I19L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: I19L

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106192
AA Change: I19L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: I19L

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196552
AA Change: I19L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000196857
AA Change: I19L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143513
Gene: ENSMUSG00000028256
AA Change: I19L

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197657
Predicted Effect probably benign
Transcript: ENSMUST00000198764
Predicted Effect probably benign
Transcript: ENSMUST00000199124
AA Change: I19L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199435
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 145127873 missense possibly damaging 0.93
IGL00821:Odf2l APN 3 145150987 missense probably damaging 1.00
IGL01984:Odf2l APN 3 145139829 nonsense probably null
R0080:Odf2l UTSW 3 145124323 missense possibly damaging 0.63
R0133:Odf2l UTSW 3 145148541 missense probably damaging 0.96
R0436:Odf2l UTSW 3 145126116 missense possibly damaging 0.91
R1218:Odf2l UTSW 3 145148932 missense probably damaging 1.00
R1521:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R1677:Odf2l UTSW 3 145139782 critical splice acceptor site probably null
R1884:Odf2l UTSW 3 145151048 missense probably damaging 1.00
R2151:Odf2l UTSW 3 145149024 missense possibly damaging 0.86
R2910:Odf2l UTSW 3 145124323 missense probably benign 0.00
R4552:Odf2l UTSW 3 145151083 missense probably benign 0.02
R4640:Odf2l UTSW 3 145128945 missense probably damaging 1.00
R4667:Odf2l UTSW 3 145128040 missense probably benign 0.04
R5472:Odf2l UTSW 3 145146866 missense probably benign 0.00
R5769:Odf2l UTSW 3 145135731 missense possibly damaging 0.91
R5877:Odf2l UTSW 3 145129010 unclassified probably null
R6026:Odf2l UTSW 3 145149036 missense possibly damaging 0.93
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6031:Odf2l UTSW 3 145139863 missense probably damaging 1.00
R6351:Odf2l UTSW 3 145135718 missense probably benign 0.11
R6454:Odf2l UTSW 3 145153420 missense possibly damaging 0.93
R6462:Odf2l UTSW 3 145146911 missense probably damaging 1.00
R6888:Odf2l UTSW 3 145148618 critical splice donor site probably null
R7008:Odf2l UTSW 3 145132734 missense probably damaging 1.00
R7121:Odf2l UTSW 3 145139820 missense possibly damaging 0.93
R7151:Odf2l UTSW 3 145127066 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGTAACTAGAACATAAGTGAGTAGCAT -3'
(R):5'- CCCTAACCTGCTGAGTAAGTATT -3'

Sequencing Primer
(F):5'- CCTGGAGCTTGCTAGGTAAAC -3'
(R):5'- AGGGCTATTCGTGAATGG -3'
Posted On2015-01-23