Incidental Mutation 'R2911:Fbxo38'
ID261276
Institutional Source Beutler Lab
Gene Symbol Fbxo38
Ensembl Gene ENSMUSG00000042211
Gene NameF-box protein 38
Synonyms6030410I24Rik, SP329
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62504069-62548743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62519807 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 523 (D523G)
Ref Sequence ENSEMBL: ENSMUSP00000047541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048688]
Predicted Effect probably benign
Transcript: ENSMUST00000048688
AA Change: D523G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047541
Gene: ENSMUSG00000042211
AA Change: D523G

DomainStartEndE-ValueType
Pfam:F-box 29 66 2.6e-5 PFAM
SCOP:d1fqva2 127 357 6e-4 SMART
low complexity region 493 525 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 705 728 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Fbxo38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Fbxo38 APN 18 62530800 missense possibly damaging 0.59
IGL01384:Fbxo38 APN 18 62522416 missense probably damaging 0.98
IGL01443:Fbxo38 APN 18 62533670 missense probably damaging 1.00
IGL01515:Fbxo38 APN 18 62518571 missense probably benign 0.00
IGL01621:Fbxo38 APN 18 62522524 splice site probably benign
IGL01975:Fbxo38 APN 18 62515413 missense probably damaging 1.00
IGL02148:Fbxo38 APN 18 62536227 missense probably benign 0.02
IGL02390:Fbxo38 APN 18 62533589 missense probably damaging 1.00
IGL03040:Fbxo38 APN 18 62527252 missense probably damaging 1.00
IGL03088:Fbxo38 APN 18 62522472 missense possibly damaging 0.86
IGL03290:Fbxo38 APN 18 62526163 missense probably benign 0.08
FR4976:Fbxo38 UTSW 18 62515347 small deletion probably benign
R0526:Fbxo38 UTSW 18 62505980 missense probably damaging 1.00
R0529:Fbxo38 UTSW 18 62505986 missense probably damaging 1.00
R0789:Fbxo38 UTSW 18 62515499 missense possibly damaging 0.84
R1232:Fbxo38 UTSW 18 62510811 missense probably damaging 1.00
R1857:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1859:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1872:Fbxo38 UTSW 18 62517023 missense probably benign 0.01
R2114:Fbxo38 UTSW 18 62506640 missense possibly damaging 0.71
R2910:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R3406:Fbxo38 UTSW 18 62514843 missense probably damaging 0.99
R3731:Fbxo38 UTSW 18 62515328 small deletion probably benign
R3792:Fbxo38 UTSW 18 62533462 intron probably null
R3848:Fbxo38 UTSW 18 62515073 missense possibly damaging 0.87
R3948:Fbxo38 UTSW 18 62529544 splice site probably benign
R4151:Fbxo38 UTSW 18 62515328 small deletion probably benign
R4323:Fbxo38 UTSW 18 62515161 missense probably benign
R4456:Fbxo38 UTSW 18 62526249 missense probably damaging 1.00
R4786:Fbxo38 UTSW 18 62529674 missense probably damaging 1.00
R4829:Fbxo38 UTSW 18 62518591 missense probably benign
R4959:Fbxo38 UTSW 18 62522507 missense probably benign 0.45
R5274:Fbxo38 UTSW 18 62515069 missense probably damaging 0.98
R5288:Fbxo38 UTSW 18 62540971 missense probably benign
R5384:Fbxo38 UTSW 18 62540971 missense probably benign
R5385:Fbxo38 UTSW 18 62540971 missense probably benign
R5448:Fbxo38 UTSW 18 62522457 missense possibly damaging 0.59
R5540:Fbxo38 UTSW 18 62514793 critical splice donor site probably null
R5588:Fbxo38 UTSW 18 62526177 missense probably damaging 1.00
R5617:Fbxo38 UTSW 18 62505971 missense probably damaging 1.00
R5636:Fbxo38 UTSW 18 62511018 missense possibly damaging 0.80
R5769:Fbxo38 UTSW 18 62514965 missense probably benign 0.10
R6254:Fbxo38 UTSW 18 62505500 synonymous probably null
R6315:Fbxo38 UTSW 18 62536147 nonsense probably null
R6517:Fbxo38 UTSW 18 62533563 missense probably damaging 1.00
R6673:Fbxo38 UTSW 18 62533915 missense probably damaging 1.00
R6974:Fbxo38 UTSW 18 62506669 missense possibly damaging 0.95
R7022:Fbxo38 UTSW 18 62536224 missense probably damaging 1.00
R7175:Fbxo38 UTSW 18 62515473 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATGTACCCTAATCCCCAGGATC -3'
(R):5'- AGAAGTACATGGTGTGTTTGCC -3'

Sequencing Primer
(F):5'- AGGATCAATTACCATTCCCGTTC -3'
(R):5'- CCTAGGGCTGTGCTCGAGTTG -3'
Posted On2015-01-23