Incidental Mutation 'R2912:Vmn1r42'
ID261299
Institutional Source Beutler Lab
Gene Symbol Vmn1r42
Ensembl Gene ENSMUSG00000068232
Gene Namevomeronasal 1 receptor 42
SynonymsV1ra6
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89842573-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89844706 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 294 (M294V)
Ref Sequence ENSEMBL: ENSMUSP00000154442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089419] [ENSMUST00000226436] [ENSMUST00000227279]
Predicted Effect probably benign
Transcript: ENSMUST00000089419
AA Change: M294V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086840
Gene: ENSMUSG00000068232
AA Change: M294V

DomainStartEndE-ValueType
Pfam:V1R 54 318 3.6e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226436
AA Change: M294V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227279
AA Change: M294V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Vmn1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Vmn1r42 APN 6 89845589 utr 5 prime probably benign
IGL02151:Vmn1r42 APN 6 89845041 missense possibly damaging 0.90
IGL02158:Vmn1r42 APN 6 89845314 missense probably damaging 0.96
IGL02731:Vmn1r42 APN 6 89845425 missense probably benign 0.41
IGL02738:Vmn1r42 APN 6 89844648 missense possibly damaging 0.69
IGL02817:Vmn1r42 APN 6 89845536 missense probably damaging 1.00
volkan UTSW 6 89844967 missense probably benign 0.00
R1131:Vmn1r42 UTSW 6 89845569 missense possibly damaging 0.88
R1500:Vmn1r42 UTSW 6 89845501 missense probably benign 0.01
R1557:Vmn1r42 UTSW 6 89844751 missense possibly damaging 0.66
R1561:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1574:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1857:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1858:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1916:Vmn1r42 UTSW 6 89844967 missense probably benign 0.00
R2284:Vmn1r42 UTSW 6 89844699 missense probably benign 0.26
R4541:Vmn1r42 UTSW 6 89845551 missense probably benign
R5085:Vmn1r42 UTSW 6 89844616 missense probably benign 0.00
R5384:Vmn1r42 UTSW 6 89845384 missense probably damaging 1.00
R5616:Vmn1r42 UTSW 6 89845102 missense possibly damaging 0.66
R5647:Vmn1r42 UTSW 6 89845332 missense probably benign 0.43
R5867:Vmn1r42 UTSW 6 89844779 nonsense probably null
R6569:Vmn1r42 UTSW 6 89845443 missense probably damaging 1.00
R6852:Vmn1r42 UTSW 6 89844787 missense possibly damaging 0.71
R7054:Vmn1r42 UTSW 6 89845069 missense possibly damaging 0.90
R7399:Vmn1r42 UTSW 6 89845513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATTTGGCAAAGCACATAGACAGC -3'
(R):5'- TAGCCCTCTTAAGCATGCAC -3'

Sequencing Primer
(F):5'- CATGCCATGACTGACAGTTCTGATG -3'
(R):5'- GGAAACAGACACAGCATCTTCATGG -3'
Posted On2015-01-23