Incidental Mutation 'R2912:Rfx6'
ID 261314
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Name regulatory factor X, 6
Synonyms 4930572O07Rik, Rfxdc1
MMRRC Submission 040499-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2912 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 51553856-51606525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51594226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 382 (D382G)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
AlphaFold Q8C7R7
Predicted Effect probably damaging
Transcript: ENSMUST00000050455
AA Change: D152G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: D152G

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000122922
AA Change: D416G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: D416G

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably damaging
Transcript: ENSMUST00000219364
AA Change: D382G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000219771
AA Change: D203G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,020,866 (GRCm39) K197M probably damaging Het
Asxl2 A G 12: 3,524,517 (GRCm39) K182E probably benign Het
Birc6 A G 17: 74,999,201 (GRCm39) D4643G probably damaging Het
Bmpr1b T C 3: 141,586,139 (GRCm39) D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Creb3l1 T C 2: 91,817,398 (GRCm39) T372A possibly damaging Het
Dbn1 A G 13: 55,630,234 (GRCm39) F45L probably damaging Het
Dhx29 A G 13: 113,072,109 (GRCm39) E251G probably damaging Het
Dnajc27 C T 12: 4,146,280 (GRCm39) S103L probably damaging Het
Dync1li1 T G 9: 114,544,743 (GRCm39) N348K probably benign Het
Emc1 T C 4: 139,092,571 (GRCm39) S504P possibly damaging Het
F5 A G 1: 164,021,488 (GRCm39) D1321G probably damaging Het
Garin4 T C 1: 190,895,425 (GRCm39) N406S probably benign Het
Gpr157 G A 4: 150,183,222 (GRCm39) V131I probably benign Het
Hprt1 T C X: 52,109,016 (GRCm39) Y174H probably damaging Het
Kcnq2 A G 2: 180,723,567 (GRCm39) V603A probably damaging Het
Lama2 T C 10: 26,876,799 (GRCm39) S2716G probably benign Het
Lax1 A G 1: 133,611,791 (GRCm39) V48A possibly damaging Het
Macf1 T A 4: 123,369,704 (GRCm39) I121F probably damaging Het
Med17 A G 9: 15,187,210 (GRCm39) L188P probably damaging Het
Mfsd5 A G 15: 102,189,743 (GRCm39) T372A probably benign Het
Mrgprb5 T C 7: 47,817,815 (GRCm39) S307G probably benign Het
Mroh9 T C 1: 162,871,572 (GRCm39) Y637C probably damaging Het
Nherf2 C T 17: 24,861,215 (GRCm39) G71S probably damaging Het
Nktr T C 9: 121,578,670 (GRCm39) probably benign Het
Nrg1 A G 8: 32,308,595 (GRCm39) S474P probably damaging Het
Nup210 T G 6: 91,003,956 (GRCm39) D644A probably damaging Het
Or10ak7 A G 4: 118,791,898 (GRCm39) I47T probably benign Het
Or4c11 A T 2: 88,695,458 (GRCm39) N170Y probably benign Het
Or5j3 A G 2: 86,128,733 (GRCm39) D191G probably damaging Het
Or8g34 T C 9: 39,373,512 (GRCm39) Y259H probably damaging Het
Panx2 A G 15: 88,954,024 (GRCm39) I660V probably benign Het
Pramel13 T C 4: 144,119,304 (GRCm39) E421G probably damaging Het
Prx C T 7: 27,215,654 (GRCm39) P52S probably damaging Het
Ptprf A G 4: 118,106,177 (GRCm39) S206P probably damaging Het
Rbm45 C T 2: 76,205,798 (GRCm39) P217S probably benign Het
Ric3 A G 7: 108,653,660 (GRCm39) F144L possibly damaging Het
Snx29 C T 16: 11,265,317 (GRCm39) R516W probably damaging Het
Trank1 T C 9: 111,221,551 (GRCm39) S2763P probably damaging Het
Vmn1r42 T C 6: 89,821,688 (GRCm39) M294V probably benign Het
Zfp467 C A 6: 48,416,010 (GRCm39) R214L possibly damaging Het
Zfp750 C A 11: 121,403,153 (GRCm39) A532S probably benign Het
Zscan4d G A 7: 10,896,614 (GRCm39) P252L probably benign Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51,557,982 (GRCm39) missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51,554,501 (GRCm39) missense probably benign 0.16
IGL01639:Rfx6 APN 10 51,592,002 (GRCm39) nonsense probably null
IGL01721:Rfx6 APN 10 51,599,173 (GRCm39) missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51,597,675 (GRCm39) missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51,602,952 (GRCm39) missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51,554,108 (GRCm39) missense probably benign
IGL02479:Rfx6 APN 10 51,554,424 (GRCm39) missense probably benign 0.07
IGL02592:Rfx6 APN 10 51,592,119 (GRCm39) missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51,592,122 (GRCm39) missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51,599,942 (GRCm39) missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51,599,217 (GRCm39) nonsense probably null
IGL03263:Rfx6 APN 10 51,601,903 (GRCm39) missense probably benign 0.00
IGL03373:Rfx6 APN 10 51,596,096 (GRCm39) missense probably damaging 0.99
bulky UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R0060:Rfx6 UTSW 10 51,553,936 (GRCm39) missense probably benign 0.00
R0433:Rfx6 UTSW 10 51,596,124 (GRCm39) missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51,569,833 (GRCm39) missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51,554,498 (GRCm39) missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51,599,221 (GRCm39) critical splice donor site probably null
R2017:Rfx6 UTSW 10 51,597,700 (GRCm39) missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51,596,153 (GRCm39) critical splice donor site probably null
R2044:Rfx6 UTSW 10 51,594,222 (GRCm39) missense probably benign 0.16
R2495:Rfx6 UTSW 10 51,602,771 (GRCm39) splice site probably benign
R2655:Rfx6 UTSW 10 51,569,873 (GRCm39) splice site probably benign
R3159:Rfx6 UTSW 10 51,602,816 (GRCm39) missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51,602,842 (GRCm39) missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51,599,880 (GRCm39) missense probably benign 0.16
R4791:Rfx6 UTSW 10 51,596,040 (GRCm39) splice site probably null
R4945:Rfx6 UTSW 10 51,602,947 (GRCm39) nonsense probably null
R5223:Rfx6 UTSW 10 51,554,092 (GRCm39) nonsense probably null
R5233:Rfx6 UTSW 10 51,588,187 (GRCm39) nonsense probably null
R5448:Rfx6 UTSW 10 51,559,733 (GRCm39) missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51,599,157 (GRCm39) missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51,602,976 (GRCm39) missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51,601,964 (GRCm39) missense probably benign 0.00
R5949:Rfx6 UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R6001:Rfx6 UTSW 10 51,594,307 (GRCm39) splice site probably null
R6003:Rfx6 UTSW 10 51,584,683 (GRCm39) missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51,587,962 (GRCm39) missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51,601,586 (GRCm39) missense probably benign 0.02
R6876:Rfx6 UTSW 10 51,596,087 (GRCm39) missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51,592,135 (GRCm39) missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51,599,949 (GRCm39) missense probably benign 0.00
R7130:Rfx6 UTSW 10 51,554,476 (GRCm39) nonsense probably null
R7574:Rfx6 UTSW 10 51,557,914 (GRCm39) missense probably benign 0.17
R7845:Rfx6 UTSW 10 51,554,122 (GRCm39) missense probably benign 0.05
R8188:Rfx6 UTSW 10 51,594,292 (GRCm39) missense probably benign 0.05
R8338:Rfx6 UTSW 10 51,594,190 (GRCm39) missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51,601,501 (GRCm39) missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51,557,968 (GRCm39) missense probably damaging 1.00
R8982:Rfx6 UTSW 10 51,599,915 (GRCm39) missense probably benign 0.14
R9104:Rfx6 UTSW 10 51,599,106 (GRCm39) missense probably damaging 1.00
R9154:Rfx6 UTSW 10 51,597,600 (GRCm39) missense probably benign 0.01
R9188:Rfx6 UTSW 10 51,594,263 (GRCm39) missense probably benign 0.04
R9388:Rfx6 UTSW 10 51,554,117 (GRCm39) missense possibly damaging 0.60
V8831:Rfx6 UTSW 10 51,594,304 (GRCm39) critical splice donor site probably null
X0023:Rfx6 UTSW 10 51,554,507 (GRCm39) missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51,601,927 (GRCm39) nonsense probably null
Z1176:Rfx6 UTSW 10 51,594,189 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTATTTACACTCAGACACACTCAAG -3'
(R):5'- GCTGTGATTTTGCTATCAGAGACATTC -3'

Sequencing Primer
(F):5'- TCAGACACACTCAAGAGAGAAG -3'
(R):5'- ACCCTGTGAAAGGCTCATTG -3'
Posted On 2015-01-23