Incidental Mutation 'R2912:Dbn1'
ID261319
Institutional Source Beutler Lab
Gene Symbol Dbn1
Ensembl Gene ENSMUSG00000034675
Gene Namedrebrin 1
Synonymsdrebrin A, drebrin E2
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55473429-55488111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55482421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 45 (F45L)
Ref Sequence ENSEMBL: ENSMUSP00000122574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021950] [ENSMUST00000109921] [ENSMUST00000109923] [ENSMUST00000139275]
Predicted Effect probably benign
Transcript: ENSMUST00000021950
AA Change: F108L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021950
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 453 473 N/A INTRINSIC
low complexity region 477 498 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
low complexity region 697 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109921
AA Change: F108L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105547
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 652 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109923
AA Change: F108L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105549
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 651 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135705
Predicted Effect probably damaging
Transcript: ENSMUST00000139275
AA Change: F45L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122574
Gene: ENSMUSG00000034675
AA Change: F45L

DomainStartEndE-ValueType
Pfam:Cofilin_ADF 1 71 9.1e-14 PFAM
coiled coil region 113 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183653
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired cued conditioning behavior. Mice homozygous for a different knock-out allele show altered neurotransmitter receptor levels in protein complexes, abnormal dendritic spine morphology, and impaired synaptic plasticity in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Dbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Dbn1 APN 13 55482189 missense probably damaging 1.00
IGL01408:Dbn1 APN 13 55482304 splice site probably benign
IGL02123:Dbn1 APN 13 55476740 missense possibly damaging 0.82
R0026:Dbn1 UTSW 13 55477784 missense probably damaging 1.00
R0318:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0319:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0400:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0417:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0765:Dbn1 UTSW 13 55482294 missense probably damaging 1.00
R0905:Dbn1 UTSW 13 55474227 unclassified probably benign
R1695:Dbn1 UTSW 13 55476708 missense probably benign 0.01
R1844:Dbn1 UTSW 13 55481347 critical splice donor site probably null
R1997:Dbn1 UTSW 13 55482441 missense probably damaging 1.00
R2914:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R4398:Dbn1 UTSW 13 55475381 missense probably benign 0.05
R4477:Dbn1 UTSW 13 55481561 small deletion probably benign
R4515:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4518:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4519:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4678:Dbn1 UTSW 13 55475258 missense probably benign
R4886:Dbn1 UTSW 13 55477542 unclassified probably benign
R6272:Dbn1 UTSW 13 55475104 missense probably benign 0.00
R6741:Dbn1 UTSW 13 55481537 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAATACTGGGCTGGAGAG -3'
(R):5'- ACACTAGTTCTTGGGAAGATAGC -3'

Sequencing Primer
(F):5'- TGCCAGTCCATTGGAGAGC -3'
(R):5'- AGATAGCCTGGGCCCATAG -3'
Posted On2015-01-23