Incidental Mutation 'R2899:Fbxo3'
ID261400
Institutional Source Beutler Lab
Gene Symbol Fbxo3
Ensembl Gene ENSMUSG00000027180
Gene NameF-box protein 3
SynonymsFba, 1200002G09Rik, 1700026K02Rik
MMRRC Submission 040487-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R2899 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104027721-104063240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104051135 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 271 (Y271N)
Ref Sequence ENSEMBL: ENSMUSP00000099625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000102565] [ENSMUST00000111135] [ENSMUST00000111136]
Predicted Effect probably damaging
Transcript: ENSMUST00000028603
AA Change: Y271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180
AA Change: Y271N

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102565
AA Change: Y271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099625
Gene: ENSMUSG00000027180
AA Change: Y271N

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 385 1.8e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111135
AA Change: Y266N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106765
Gene: ENSMUSG00000027180
AA Change: Y266N

DomainStartEndE-ValueType
SCOP:d1fs1a1 14 48 4e-3 SMART
Blast:FBOX 16 51 2e-13 BLAST
SMI1_KNR4 116 246 3.02e-5 SMART
Pfam:DUF525 288 380 1.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111136
AA Change: Y271N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106766
Gene: ENSMUSG00000027180
AA Change: Y271N

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 361 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143799
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,682 K211E probably benign Het
4930430A15Rik C A 2: 111,220,670 probably benign Het
Amigo3 T C 9: 108,054,154 S259P probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cd200r4 T C 16: 44,833,365 I175T probably damaging Het
Cep131 T C 11: 120,072,028 D425G probably benign Het
Clmp T C 9: 40,782,392 S302P probably damaging Het
Dusp6 T C 10: 99,263,845 S52P probably damaging Het
Epha5 T A 5: 84,233,808 I395F probably damaging Het
F5 A G 1: 164,186,900 E580G possibly damaging Het
Fuca1 G A 4: 135,923,012 W131* probably null Het
Gdf7 C T 12: 8,298,470 A276T unknown Het
Limk1 A T 5: 134,688,300 probably null Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Neb A G 2: 52,185,323 I210T probably benign Het
Nf1 T G 11: 79,412,758 N420K possibly damaging Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Pask G T 1: 93,334,547 T197K probably damaging Het
Pou4f3 T C 18: 42,395,523 L177P probably benign Het
Rassf1 G A 9: 107,554,194 G107R probably null Het
Rdx T C 9: 52,068,911 probably benign Het
Saraf T C 8: 34,161,231 L77P probably damaging Het
Syngap1 A G 17: 26,959,985 E483G probably damaging Het
Tsku T C 7: 98,352,917 N69S probably damaging Het
Usp36 G A 11: 118,276,756 probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zc3h6 T C 2: 129,002,232 V232A probably benign Het
Zfp143 T A 7: 110,072,129 S99R probably damaging Het
Zkscan3 A T 13: 21,393,973 L219Q probably damaging Het
Other mutations in Fbxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Fbxo3 APN 2 104033676 missense probably benign 0.25
IGL02187:Fbxo3 APN 2 104027950 missense probably damaging 0.99
IGL02323:Fbxo3 APN 2 104047951 missense probably benign 0.38
IGL02941:Fbxo3 APN 2 104050294 missense probably damaging 1.00
IGL03160:Fbxo3 APN 2 104030347 nonsense probably null
IGL03346:Fbxo3 APN 2 104050294 missense probably damaging 1.00
R2163:Fbxo3 UTSW 2 104054985 missense probably benign 0.20
R4256:Fbxo3 UTSW 2 104051165 missense probably damaging 1.00
R4663:Fbxo3 UTSW 2 104053475 missense probably damaging 1.00
R4914:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4915:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4918:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R7001:Fbxo3 UTSW 2 104051224 missense probably damaging 1.00
R7223:Fbxo3 UTSW 2 104043012 missense possibly damaging 0.86
R7226:Fbxo3 UTSW 2 104050297 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGACCATGATGGCTGTCTATAC -3'
(R):5'- GTTCACCAAAGTTGATTCCTCGG -3'

Sequencing Primer
(F):5'- ATGGCTGTCTATACTGAACCAGG -3'
(R):5'- GGGGGTTTTGTCATGGAAAC -3'
Posted On2015-01-23