Incidental Mutation 'R2899:4930430A15Rik'
ID261401
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene NameRIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission 040487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2899 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111162061-111229602 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 111220670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577]
Predicted Effect probably benign
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,682 K211E probably benign Het
Amigo3 T C 9: 108,054,154 S259P probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cd200r4 T C 16: 44,833,365 I175T probably damaging Het
Cep131 T C 11: 120,072,028 D425G probably benign Het
Clmp T C 9: 40,782,392 S302P probably damaging Het
Dusp6 T C 10: 99,263,845 S52P probably damaging Het
Epha5 T A 5: 84,233,808 I395F probably damaging Het
F5 A G 1: 164,186,900 E580G possibly damaging Het
Fbxo3 T A 2: 104,051,135 Y271N probably damaging Het
Fuca1 G A 4: 135,923,012 W131* probably null Het
Gdf7 C T 12: 8,298,470 A276T unknown Het
Limk1 A T 5: 134,688,300 probably null Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Neb A G 2: 52,185,323 I210T probably benign Het
Nf1 T G 11: 79,412,758 N420K possibly damaging Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Pask G T 1: 93,334,547 T197K probably damaging Het
Pou4f3 T C 18: 42,395,523 L177P probably benign Het
Rassf1 G A 9: 107,554,194 G107R probably null Het
Rdx T C 9: 52,068,911 probably benign Het
Saraf T C 8: 34,161,231 L77P probably damaging Het
Syngap1 A G 17: 26,959,985 E483G probably damaging Het
Tsku T C 7: 98,352,917 N69S probably damaging Het
Usp36 G A 11: 118,276,756 probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zc3h6 T C 2: 129,002,232 V232A probably benign Het
Zfp143 T A 7: 110,072,129 S99R probably damaging Het
Zkscan3 A T 13: 21,393,973 L219Q probably damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTACTTGGTTCAATCTTCAGC -3'
(R):5'- ACAGAAGGCTTCCTACCCATTC -3'

Sequencing Primer
(F):5'- GGTTCAATCTTCAGCATTTCCAAATC -3'
(R):5'- AATGAACTCTTGCTTACCATAGTG -3'
Posted On2015-01-23